Incidental Mutation 'R0046:Or4c109'
ID 43685
Institutional Source Beutler Lab
Gene Symbol Or4c109
Ensembl Gene ENSMUSG00000075110
Gene Name olfactory receptor family 4 subfamily C member 109
Synonyms GA_x6K02T2Q125-50468705-50467770, MOR233-8, Olfr1214
MMRRC Submission 038340-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R0046 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 88817609-88818544 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88817693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 284 (M284I)
Ref Sequence ENSEMBL: ENSMUSP00000150322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099804] [ENSMUST00000216026] [ENSMUST00000217469]
AlphaFold A2ATG3
Predicted Effect probably benign
Transcript: ENSMUST00000099804
AA Change: M284I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097392
Gene: ENSMUSG00000075110
AA Change: M284I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-45 PFAM
Pfam:7tm_1 39 286 4.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216026
AA Change: M284I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000217469
AA Change: M284I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 (GRCm39) K135* probably null Het
Adamts16 A G 13: 70,911,579 (GRCm39) S871P probably benign Het
Adcy10 A T 1: 165,367,403 (GRCm39) I558F probably damaging Het
Adsl T G 15: 80,846,989 (GRCm39) probably null Het
Aldob T C 4: 49,543,842 (GRCm39) I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 (GRCm39) E46G probably damaging Het
Ankrd33b G A 15: 31,367,483 (GRCm39) P19L probably damaging Het
Apoa5 T C 9: 46,181,296 (GRCm39) L124S probably damaging Het
Atp1a4 A T 1: 172,067,664 (GRCm39) L533Q probably benign Het
Atp7b T C 8: 22,550,011 (GRCm39) T9A probably benign Het
Auh G A 13: 53,083,421 (GRCm39) probably benign Het
B3gnt3 T C 8: 72,145,567 (GRCm39) Y267C probably damaging Het
Card11 T C 5: 140,894,279 (GRCm39) T117A possibly damaging Het
Ccdc39 A G 3: 33,898,301 (GRCm39) F15L possibly damaging Het
Chtf18 C T 17: 25,942,434 (GRCm39) R468Q probably benign Het
Cntnap5c T G 17: 58,666,295 (GRCm39) D1108E probably benign Het
Col14a1 G A 15: 55,272,359 (GRCm39) probably benign Het
Col6a6 C T 9: 105,626,047 (GRCm39) probably benign Het
Col9a3 G A 2: 180,251,280 (GRCm39) A317T possibly damaging Het
Cpt1c A T 7: 44,609,256 (GRCm39) probably benign Het
Cpt2 A G 4: 107,761,559 (GRCm39) probably null Het
Crebrf T A 17: 26,982,308 (GRCm39) L565M probably damaging Het
Cyp2d41-ps T A 15: 82,666,236 (GRCm39) noncoding transcript Het
Dhx9 C T 1: 153,348,453 (GRCm39) V291M probably benign Het
Dmxl1 T A 18: 50,011,149 (GRCm39) V1102E probably benign Het
Dnah7a A T 1: 53,496,033 (GRCm39) probably null Het
Dock4 G A 12: 40,787,359 (GRCm39) probably benign Het
Dpp3 G T 19: 4,964,671 (GRCm39) N545K probably damaging Het
Elmo2 T A 2: 165,140,646 (GRCm39) N275I probably damaging Het
Farp1 A G 14: 121,492,925 (GRCm39) K509R probably benign Het
Fat3 T C 9: 15,877,275 (GRCm39) Y3446C possibly damaging Het
Fgd2 T A 17: 29,593,964 (GRCm39) probably benign Het
Flg T A 3: 93,185,028 (GRCm39) probably benign Het
Gas2l2 A T 11: 83,312,736 (GRCm39) W859R probably damaging Het
Gatm T C 2: 122,431,225 (GRCm39) D254G probably damaging Het
Gjd4 T A 18: 9,280,998 (GRCm39) I27F probably damaging Het
Gsdmc2 C A 15: 63,699,604 (GRCm39) probably benign Het
Haus5 C T 7: 30,353,605 (GRCm39) V591I probably benign Het
Kcnab3 G A 11: 69,221,053 (GRCm39) probably null Het
Khdrbs2 A G 1: 32,658,283 (GRCm39) D281G possibly damaging Het
Krt86 A T 15: 101,375,283 (GRCm39) M393L probably benign Het
Limk1 T C 5: 134,701,615 (GRCm39) Y96C probably damaging Het
Lrp2bp T A 8: 46,466,192 (GRCm39) Y100* probably null Het
Mamstr T G 7: 45,291,194 (GRCm39) probably benign Het
Man1a A G 10: 53,795,283 (GRCm39) Y657H probably damaging Het
Marf1 G A 16: 13,929,591 (GRCm39) P1672S possibly damaging Het
Mboat7 T C 7: 3,686,817 (GRCm39) Y341C probably damaging Het
Nhsl1 A T 10: 18,401,417 (GRCm39) N881I probably damaging Het
Nox3 T C 17: 3,733,236 (GRCm39) Y225C probably benign Het
Nrp1 C T 8: 129,227,089 (GRCm39) probably benign Het
Or11g26 T A 14: 50,753,596 (GRCm39) *312K probably null Het
Or4c35 C T 2: 89,808,851 (GRCm39) T243I probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or8k33 A G 2: 86,383,976 (GRCm39) F164S probably damaging Het
Pcdhb13 A T 18: 37,577,310 (GRCm39) M563L probably benign Het
Pclo C T 5: 14,590,493 (GRCm39) T931M unknown Het
Peli2 C T 14: 48,358,659 (GRCm39) P16S possibly damaging Het
Pfas G T 11: 68,881,293 (GRCm39) R1025S probably benign Het
Pik3c2a A T 7: 115,953,307 (GRCm39) I1196N probably damaging Het
Pmfbp1 A T 8: 110,262,617 (GRCm39) probably benign Het
Prg4 T C 1: 150,331,837 (GRCm39) T279A possibly damaging Het
Psma1 A T 7: 113,866,440 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,643,149 (GRCm39) L550P probably damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Rmnd5a T C 6: 71,376,215 (GRCm39) H195R probably damaging Het
Rnf17 T C 14: 56,708,830 (GRCm39) L750P probably damaging Het
Rtcb T C 10: 85,793,520 (GRCm39) N18D probably benign Het
Seh1l T C 18: 67,925,086 (GRCm39) probably null Het
Sis T G 3: 72,839,427 (GRCm39) N813T probably benign Het
Sptbn2 T C 19: 4,795,405 (GRCm39) probably benign Het
Stag3 C T 5: 138,281,285 (GRCm39) probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Taok3 C T 5: 117,410,294 (GRCm39) Q829* probably null Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tsbp1 T C 17: 34,679,095 (GRCm39) probably null Het
Ttn A G 2: 76,781,886 (GRCm39) probably benign Het
Unc79 A G 12: 103,091,940 (GRCm39) E1756G probably damaging Het
Usp35 A T 7: 96,962,804 (GRCm39) probably null Het
Vmn2r111 A G 17: 22,766,990 (GRCm39) F836L probably benign Het
Vmn2r77 A G 7: 86,451,146 (GRCm39) D344G possibly damaging Het
Zbtb40 A G 4: 136,714,589 (GRCm39) C1067R probably damaging Het
Other mutations in Or4c109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Or4c109 APN 2 88,818,424 (GRCm39) missense probably benign 0.00
IGL03409:Or4c109 APN 2 88,817,931 (GRCm39) missense possibly damaging 0.93
R0046:Or4c109 UTSW 2 88,817,693 (GRCm39) missense probably benign 0.00
R0503:Or4c109 UTSW 2 88,818,322 (GRCm39) missense probably benign 0.01
R0688:Or4c109 UTSW 2 88,817,939 (GRCm39) missense probably damaging 1.00
R1120:Or4c109 UTSW 2 88,818,423 (GRCm39) missense possibly damaging 0.51
R1752:Or4c109 UTSW 2 88,817,659 (GRCm39) missense possibly damaging 0.60
R2018:Or4c109 UTSW 2 88,818,489 (GRCm39) missense probably benign 0.06
R2281:Or4c109 UTSW 2 88,817,814 (GRCm39) missense probably benign 0.03
R2509:Or4c109 UTSW 2 88,817,775 (GRCm39) missense probably damaging 1.00
R2862:Or4c109 UTSW 2 88,817,664 (GRCm39) missense probably benign
R3942:Or4c109 UTSW 2 88,818,455 (GRCm39) missense probably benign 0.15
R4894:Or4c109 UTSW 2 88,817,783 (GRCm39) missense possibly damaging 0.83
R4899:Or4c109 UTSW 2 88,818,454 (GRCm39) missense probably null 0.13
R5089:Or4c109 UTSW 2 88,818,516 (GRCm39) missense probably damaging 1.00
R5253:Or4c109 UTSW 2 88,818,444 (GRCm39) missense possibly damaging 0.67
R5338:Or4c109 UTSW 2 88,817,809 (GRCm39) missense possibly damaging 0.87
R6476:Or4c109 UTSW 2 88,817,721 (GRCm39) missense probably benign 0.06
R8411:Or4c109 UTSW 2 88,818,409 (GRCm39) missense probably benign 0.26
R9209:Or4c109 UTSW 2 88,818,057 (GRCm39) nonsense probably null
R9650:Or4c109 UTSW 2 88,818,006 (GRCm39) nonsense probably null
Z1177:Or4c109 UTSW 2 88,818,225 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCATGCACATGCCAGAAGAACATGAG -3'
(R):5'- TGAAGCTTGCCTGCACTGATATACAC -3'

Sequencing Primer
(F):5'- cctgcctggttctggttc -3'
(R):5'- GTTCTCTCTGAGAGCCCACAG -3'
Posted On 2013-05-29