Incidental Mutation 'R5566:Zcchc6'
ID436858
Institutional Source Beutler Lab
Gene Symbol Zcchc6
Ensembl Gene ENSMUSG00000035248
Gene Namezinc finger, CCHC domain containing 6
Synonyms6030448M23Rik
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59771561-59823147 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 59788629 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 817 (C817*)
Ref Sequence ENSEMBL: ENSMUSP00000153376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071703] [ENSMUST00000224480]
Predicted Effect probably null
Transcript: ENSMUST00000071703
AA Change: C1219*
SMART Domains Protein: ENSMUSP00000071623
Gene: ENSMUSG00000035248
AA Change: C1219*

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
ZnF_C2H2 244 268 2.61e1 SMART
SCOP:d1f5aa2 284 497 4e-25 SMART
low complexity region 522 534 N/A INTRINSIC
Pfam:PAP_assoc 550 603 6.7e-14 PFAM
low complexity region 811 825 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 882 898 N/A INTRINSIC
ZnF_C2HC 960 976 3.3e-3 SMART
Pfam:NTP_transf_2 1022 1134 4e-8 PFAM
Pfam:PAP_assoc 1229 1282 1.7e-17 PFAM
ZnF_C2HC 1342 1358 2.09e-3 SMART
Pfam:TUTF7_u4 1359 1446 1.6e-42 PFAM
ZnF_C2HC 1448 1464 1.06e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224320
Predicted Effect probably null
Transcript: ENSMUST00000224480
AA Change: C817*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225607
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Zcchc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Zcchc6 APN 13 59816698 missense probably damaging 1.00
IGL01361:Zcchc6 APN 13 59785800 missense probably damaging 1.00
IGL02002:Zcchc6 APN 13 59782096 missense possibly damaging 0.76
IGL02015:Zcchc6 APN 13 59789258 missense probably damaging 1.00
IGL02029:Zcchc6 APN 13 59784888 unclassified probably benign
IGL02216:Zcchc6 APN 13 59800423 missense probably benign 0.01
IGL02705:Zcchc6 APN 13 59789203 missense probably damaging 1.00
IGL02742:Zcchc6 APN 13 59816342 missense probably damaging 0.99
IGL02810:Zcchc6 APN 13 59782016 critical splice donor site probably null
IGL02942:Zcchc6 APN 13 59811521 missense probably damaging 0.98
IGL03104:Zcchc6 APN 13 59814903 missense probably benign 0.04
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0153:Zcchc6 UTSW 13 59782336 nonsense probably null
R0269:Zcchc6 UTSW 13 59816855 splice site probably null
R0358:Zcchc6 UTSW 13 59782104 missense probably damaging 0.99
R0555:Zcchc6 UTSW 13 59800317 missense probably benign 0.00
R0599:Zcchc6 UTSW 13 59809487 missense probably damaging 1.00
R0609:Zcchc6 UTSW 13 59799782 nonsense probably null
R0617:Zcchc6 UTSW 13 59816855 splice site probably null
R0680:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R0699:Zcchc6 UTSW 13 59782014 splice site probably benign
R1214:Zcchc6 UTSW 13 59805326 missense possibly damaging 0.76
R1271:Zcchc6 UTSW 13 59821855 missense probably damaging 0.99
R1556:Zcchc6 UTSW 13 59800240 missense probably benign 0.02
R1662:Zcchc6 UTSW 13 59799903 missense possibly damaging 0.93
R1777:Zcchc6 UTSW 13 59791821 missense probably damaging 1.00
R1834:Zcchc6 UTSW 13 59814935 nonsense probably null
R1928:Zcchc6 UTSW 13 59816734 missense probably damaging 1.00
R2012:Zcchc6 UTSW 13 59811538 missense probably damaging 0.99
R2045:Zcchc6 UTSW 13 59800656 missense probably damaging 1.00
R2336:Zcchc6 UTSW 13 59799054 missense probably damaging 1.00
R3764:Zcchc6 UTSW 13 59800380 missense probably damaging 0.98
R3899:Zcchc6 UTSW 13 59789255 nonsense probably null
R3918:Zcchc6 UTSW 13 59782024 missense probably damaging 1.00
R4423:Zcchc6 UTSW 13 59822049 missense probably damaging 0.96
R4664:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R4673:Zcchc6 UTSW 13 59796845 missense probably damaging 1.00
R4770:Zcchc6 UTSW 13 59772884 unclassified probably benign
R4884:Zcchc6 UTSW 13 59789452 missense probably damaging 1.00
R5186:Zcchc6 UTSW 13 59816656 critical splice donor site probably null
R5337:Zcchc6 UTSW 13 59791852 missense probably damaging 1.00
R5385:Zcchc6 UTSW 13 59789846 critical splice donor site probably null
R5452:Zcchc6 UTSW 13 59800657 missense probably damaging 1.00
R5534:Zcchc6 UTSW 13 59788553 missense probably damaging 1.00
R5928:Zcchc6 UTSW 13 59822066 missense probably benign 0.16
R5994:Zcchc6 UTSW 13 59789209 missense probably damaging 1.00
R6415:Zcchc6 UTSW 13 59816296 splice site probably null
R6495:Zcchc6 UTSW 13 59799939 missense possibly damaging 0.95
R6577:Zcchc6 UTSW 13 59808161 missense probably damaging 1.00
R7205:Zcchc6 UTSW 13 59788550 missense probably damaging 1.00
R7286:Zcchc6 UTSW 13 59821649 missense probably benign 0.18
R7355:Zcchc6 UTSW 13 59821802 missense probably benign 0.00
R7369:Zcchc6 UTSW 13 59782053 missense possibly damaging 0.71
R7455:Zcchc6 UTSW 13 59822057 missense probably benign 0.03
R7557:Zcchc6 UTSW 13 59788466 missense possibly damaging 0.89
R7635:Zcchc6 UTSW 13 59800090 missense probably benign 0.03
R7727:Zcchc6 UTSW 13 59799682 missense probably benign 0.00
R7798:Zcchc6 UTSW 13 59815575 missense possibly damaging 0.81
R7912:Zcchc6 UTSW 13 59799005 missense probably damaging 1.00
R7915:Zcchc6 UTSW 13 59784814 missense probably benign 0.12
R8035:Zcchc6 UTSW 13 59789190 missense probably benign 0.00
R8531:Zcchc6 UTSW 13 59789260 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCTGCACATCATCCTC -3'
(R):5'- TCTCTACTGCAAGTCACAGAGTAG -3'

Sequencing Primer
(F):5'- GGCCAACATGTCACTTCTAATTTGAC -3'
(R):5'- AGTCACAGAGTAGGATTAATAGACTC -3'
Posted On2016-10-24