Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Dnah1'

436861

Institutional Source

Beutler Lab

Gene Symbol

Dnah1

Ensembl Gene

ENSMUSG00000019027

Gene Name

dynein, axonemal, heavy chain 1

Synonyms

E030034C22Rik, MDHC7, Dnahc1, B230373P09Rik

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31260375-31323896 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31274366 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 2671 (I2671K)

Ref Sequence

ENSEMBL: ENSMUSP00000043281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048603]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048603
AA Change: I2671K

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: I2671K

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DHC_N2	998	1404	6.3e-146	PFAM
AAA	1558	1697	6.02e-1	SMART
AAA	1839	2077	4.66e0	SMART
low complexity region	2149	2157	N/A	INTRINSIC
AAA	2204	2353	2.35e-1	SMART
Pfam:AAA_8	2533	2803	7.7e-84	PFAM
Pfam:MT	2815	3165	9.9e-57	PFAM
Pfam:AAA_9	3185	3410	1.1e-93	PFAM
Pfam:Dynein_heavy	3545	4246	2.7e-275	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228429

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228927

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Dnah1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Dnah1	APN	14	31287873	missense	probably benign	0.01
IGL00227:Dnah1	APN	14	31286896	missense	probably damaging	1.00
IGL00491:Dnah1	APN	14	31261839	missense	probably damaging	1.00
IGL00787:Dnah1	APN	14	31300063	missense	possibly damaging	0.91
IGL00809:Dnah1	APN	14	31300809	nonsense	probably null
IGL00911:Dnah1	APN	14	31304434	splice site	probably null
IGL00949:Dnah1	APN	14	31307090	missense	probably benign	0.00
IGL00976:Dnah1	APN	14	31278138	missense	probably damaging	1.00
IGL01484:Dnah1	APN	14	31299940	missense	probably damaging	0.98
IGL01629:Dnah1	APN	14	31292320	missense	probably damaging	1.00
IGL01716:Dnah1	APN	14	31263378	missense	probably benign	0.34
IGL01893:Dnah1	APN	14	31266470	missense	probably damaging	1.00
IGL01933:Dnah1	APN	14	31310915	missense	probably benign	0.40
IGL01938:Dnah1	APN	14	31283887	missense	probably benign
IGL02032:Dnah1	APN	14	31274369	missense	probably benign
IGL02052:Dnah1	APN	14	31268786	missense	probably damaging	0.99
IGL02097:Dnah1	APN	14	31305001	missense	possibly damaging	0.92
IGL02127:Dnah1	APN	14	31304928	missense	probably benign	0.00
IGL02143:Dnah1	APN	14	31283289	missense	probably damaging	1.00
IGL02158:Dnah1	APN	14	31300967	missense	probably benign	0.00
IGL02442:Dnah1	APN	14	31287878	missense	probably damaging	1.00
IGL02525:Dnah1	APN	14	31305833	missense	probably benign	0.05
IGL02558:Dnah1	APN	14	31274379	missense	possibly damaging	0.96
IGL02633:Dnah1	APN	14	31284815	missense	probably benign	0.05
IGL02720:Dnah1	APN	14	31262220	missense	probably damaging	0.96
IGL02728:Dnah1	APN	14	31283998	missense	probably benign	0.44
IGL02738:Dnah1	APN	14	31292640	missense	probably benign	0.27
IGL02863:Dnah1	APN	14	31295293	missense	probably damaging	0.99
IGL02944:Dnah1	APN	14	31300871	missense	possibly damaging	0.88
IGL03110:Dnah1	APN	14	31266717	missense	probably benign	0.40
IGL03201:Dnah1	APN	14	31300949	missense	probably benign	0.13
IGL03215:Dnah1	APN	14	31274391	missense	probably damaging	1.00
IGL03230:Dnah1	APN	14	31270066	missense	probably damaging	1.00
IGL03248:Dnah1	APN	14	31269889	missense	probably damaging	1.00
IGL03267:Dnah1	APN	14	31286588	missense	probably benign	0.00
IGL03299:Dnah1	APN	14	31315122	nonsense	probably null
IGL03301:Dnah1	APN	14	31292692	missense	probably damaging	1.00
ergonomic	UTSW	14	31300748	missense	possibly damaging	0.91
Faraday	UTSW	14	31310882	missense	probably null	0.05
K3955:Dnah1	UTSW	14	31266459	missense	probably benign
PIT1430001:Dnah1	UTSW	14	31262580	missense	probably damaging	1.00
PIT4382001:Dnah1	UTSW	14	31284455	missense	probably damaging	1.00
R0043:Dnah1	UTSW	14	31274405	missense	probably damaging	0.97
R0092:Dnah1	UTSW	14	31271609	missense	probably benign	0.00
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0101:Dnah1	UTSW	14	31283899	missense	probably damaging	1.00
R0119:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0136:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0144:Dnah1	UTSW	14	31267874	splice site	probably benign
R0279:Dnah1	UTSW	14	31302375	missense	possibly damaging	0.94
R0299:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0316:Dnah1	UTSW	14	31278151	missense	probably benign	0.00
R0739:Dnah1	UTSW	14	31265915	nonsense	probably null
R0789:Dnah1	UTSW	14	31304591	missense	probably benign
R0826:Dnah1	UTSW	14	31303907	missense	probably benign	0.02
R1102:Dnah1	UTSW	14	31296457	nonsense	probably null
R1116:Dnah1	UTSW	14	31307867	missense	probably benign	0.13
R1229:Dnah1	UTSW	14	31310851	missense	probably benign	0.11
R1447:Dnah1	UTSW	14	31306898	missense	probably benign	0.06
R1449:Dnah1	UTSW	14	31263951	missense	probably damaging	1.00
R1462:Dnah1	UTSW	14	31268781	splice site	probably benign
R1482:Dnah1	UTSW	14	31294874	missense	probably damaging	1.00
R1500:Dnah1	UTSW	14	31316758	missense	probably benign
R1512:Dnah1	UTSW	14	31293037	missense	probably damaging	1.00
R1591:Dnah1	UTSW	14	31272332	missense	probably benign	0.01
R1598:Dnah1	UTSW	14	31301262	missense	probably benign	0.07
R1644:Dnah1	UTSW	14	31302292	splice site	probably benign
R1672:Dnah1	UTSW	14	31276200	missense	probably damaging	1.00
R1713:Dnah1	UTSW	14	31279182	missense	probably damaging	1.00
R1769:Dnah1	UTSW	14	31310882	missense	probably null	0.05
R1796:Dnah1	UTSW	14	31261093	missense	probably benign	0.00
R1902:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1903:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1905:Dnah1	UTSW	14	31264630	missense	probably benign	0.06
R1908:Dnah1	UTSW	14	31262558	missense	probably damaging	1.00
R1972:Dnah1	UTSW	14	31265391	nonsense	probably null
R1973:Dnah1	UTSW	14	31265391	nonsense	probably null
R2004:Dnah1	UTSW	14	31301856	missense	possibly damaging	0.79
R2051:Dnah1	UTSW	14	31279123	missense	probably damaging	1.00
R2062:Dnah1	UTSW	14	31271129	missense	probably damaging	1.00
R2188:Dnah1	UTSW	14	31279164	missense	probably damaging	0.98
R2240:Dnah1	UTSW	14	31299974	missense	probably benign	0.00
R2862:Dnah1	UTSW	14	31284762	missense	probably benign	0.21
R2894:Dnah1	UTSW	14	31298761	missense	possibly damaging	0.67
R3120:Dnah1	UTSW	14	31266822	nonsense	probably null
R3410:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3411:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3435:Dnah1	UTSW	14	31316674	missense	probably damaging	0.96
R3615:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3616:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3741:Dnah1	UTSW	14	31265467	splice site	probably benign
R3805:Dnah1	UTSW	14	31294763	missense	possibly damaging	0.67
R3894:Dnah1	UTSW	14	31307028	missense	probably benign
R4007:Dnah1	UTSW	14	31303784	splice site	probably benign
R4201:Dnah1	UTSW	14	31262270	missense	probably benign	0.00
R4232:Dnah1	UTSW	14	31304916	missense	probably benign
R4372:Dnah1	UTSW	14	31304922	missense	probably damaging	1.00
R4391:Dnah1	UTSW	14	31294835	missense	probably damaging	1.00
R4423:Dnah1	UTSW	14	31284761	missense	probably benign	0.00
R4526:Dnah1	UTSW	14	31285998	missense	probably benign	0.05
R4650:Dnah1	UTSW	14	31284887	splice site	probably null
R4723:Dnah1	UTSW	14	31272942	missense	probably damaging	1.00
R4748:Dnah1	UTSW	14	31319945	missense	probably benign
R4783:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4784:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4785:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4843:Dnah1	UTSW	14	31264963	missense	probably damaging	1.00
R4879:Dnah1	UTSW	14	31300748	missense	possibly damaging	0.91
R4897:Dnah1	UTSW	14	31267539	missense	probably damaging	1.00
R4911:Dnah1	UTSW	14	31295323	missense	probably damaging	1.00
R4985:Dnah1	UTSW	14	31286898	missense	probably null	1.00
R5070:Dnah1	UTSW	14	31282418	missense	probably benign	0.05
R5128:Dnah1	UTSW	14	31296195	splice site	probably null
R5409:Dnah1	UTSW	14	31263255	missense	probably damaging	1.00
R5436:Dnah1	UTSW	14	31316747	missense	probably benign
R5481:Dnah1	UTSW	14	31308871	missense	possibly damaging	0.55
R5550:Dnah1	UTSW	14	31316708	missense	probably benign	0.00
R5555:Dnah1	UTSW	14	31290819	missense	probably damaging	0.99
R5623:Dnah1	UTSW	14	31286023	missense	possibly damaging	0.62
R5701:Dnah1	UTSW	14	31274044	missense	probably damaging	1.00
R5751:Dnah1	UTSW	14	31310906	missense	probably benign	0.00
R5823:Dnah1	UTSW	14	31266418	missense	possibly damaging	0.92
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6090:Dnah1	UTSW	14	31269425	missense	possibly damaging	0.83
R6139:Dnah1	UTSW	14	31286027	missense	probably benign	0.02
R6145:Dnah1	UTSW	14	31300970	missense	probably benign	0.07
R6306:Dnah1	UTSW	14	31304587	missense	probably damaging	0.97
R6376:Dnah1	UTSW	14	31275608	missense	probably damaging	1.00
R6451:Dnah1	UTSW	14	31300808	missense	probably benign	0.08
R6549:Dnah1	UTSW	14	31269383	missense	probably damaging	1.00
R6748:Dnah1	UTSW	14	31299988	missense	probably damaging	0.99
R6826:Dnah1	UTSW	14	31286290	missense	probably benign	0.00
R6870:Dnah1	UTSW	14	31271061	nonsense	probably null
R6932:Dnah1	UTSW	14	31287776	missense	probably damaging	1.00
R6944:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R7033:Dnah1	UTSW	14	31264925	missense	probably damaging	1.00
R7078:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R7133:Dnah1	UTSW	14	31286076	missense	probably benign
R7136:Dnah1	UTSW	14	31298656	missense	probably damaging	1.00
R7203:Dnah1	UTSW	14	31274382	missense	probably benign
R7241:Dnah1	UTSW	14	31264939	missense	probably benign	0.00
R7260:Dnah1	UTSW	14	31269386	missense	probably damaging	1.00
R7264:Dnah1	UTSW	14	31269894	missense	probably benign
R7291:Dnah1	UTSW	14	31298705	missense	probably damaging	1.00
R7293:Dnah1	UTSW	14	31287863	missense	probably damaging	1.00
R7300:Dnah1	UTSW	14	31269841	missense	probably benign	0.05
R7319:Dnah1	UTSW	14	31296594	missense	probably benign	0.02
R7323:Dnah1	UTSW	14	31298707	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31261590	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31300791	missense	possibly damaging	0.80
R7499:Dnah1	UTSW	14	31315122	nonsense	probably null
R7526:Dnah1	UTSW	14	31287876	missense	possibly damaging	0.49
R7560:Dnah1	UTSW	14	31304983	missense	probably benign
R7574:Dnah1	UTSW	14	31319908	missense	probably benign	0.00
R7617:Dnah1	UTSW	14	31284782	missense	possibly damaging	0.80
R7620:Dnah1	UTSW	14	31303906	missense	possibly damaging	0.47
R7692:Dnah1	UTSW	14	31292338	missense	probably benign	0.00
R7702:Dnah1	UTSW	14	31310909	missense	probably benign
R7786:Dnah1	UTSW	14	31262521	missense	probably damaging	1.00
R7984:Dnah1	UTSW	14	31267815	missense	probably damaging	1.00
R8002:Dnah1	UTSW	14	31298722	missense	probably damaging	1.00
R8022:Dnah1	UTSW	14	31265014	missense	probably damaging	1.00
R8032:Dnah1	UTSW	14	31271548	missense	probably damaging	1.00
R8099:Dnah1	UTSW	14	31302364	missense	probably benign	0.00
R8171:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R8263:Dnah1	UTSW	14	31293177	missense	probably damaging	1.00
R8274:Dnah1	UTSW	14	31295574	missense	probably benign	0.00
R8345:Dnah1	UTSW	14	31264594	missense	probably damaging	1.00
R8348:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8353:Dnah1	UTSW	14	31283202	missense	probably benign
R8356:Dnah1	UTSW	14	31273015	missense	probably benign	0.00
R8376:Dnah1	UTSW	14	31301346	missense	probably damaging	1.00
R8448:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8461:Dnah1	UTSW	14	31305958	missense	probably benign	0.00
R8534:Dnah1	UTSW	14	31301848	missense	probably benign	0.16
R8544:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R8679:Dnah1	UTSW	14	31267810	missense	possibly damaging	0.77
R8716:Dnah1	UTSW	14	31267984	critical splice donor site	probably benign
R8750:Dnah1	UTSW	14	31304967	missense	probably benign	0.30
R8790:Dnah1	UTSW	14	31296275	missense	possibly damaging	0.89
R8808:Dnah1	UTSW	14	31286814	missense	probably benign
R8821:Dnah1	UTSW	14	31296498	missense	probably benign
R8887:Dnah1	UTSW	14	31311040	missense	probably damaging	1.00
R8948:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8950:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8955:Dnah1	UTSW	14	31285993	missense	probably benign
R8987:Dnah1	UTSW	14	31311747	missense	possibly damaging	0.93
R8998:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R8999:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R9015:Dnah1	UTSW	14	31264359	missense	probably damaging	0.96
R9031:Dnah1	UTSW	14	31279171	missense	probably benign
R9088:Dnah1	UTSW	14	31266013	missense	probably benign	0.04
R9096:Dnah1	UTSW	14	31261070	missense	probably damaging	0.99
R9117:Dnah1	UTSW	14	31311624	splice site	probably benign
R9157:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9296:Dnah1	UTSW	14	31274054	critical splice acceptor site	probably null
R9313:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9325:Dnah1	UTSW	14	31276203	missense	possibly damaging	0.69
R9352:Dnah1	UTSW	14	31316663	missense	probably benign	0.00
R9411:Dnah1	UTSW	14	31296299	missense	probably damaging	1.00
R9429:Dnah1	UTSW	14	31275542	nonsense	probably null
R9452:Dnah1	UTSW	14	31296491	missense	probably benign	0.35
R9562:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9565:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9616:Dnah1	UTSW	14	31304443	missense	probably null	0.20
R9621:Dnah1	UTSW	14	31294815	missense	probably damaging	1.00
R9677:Dnah1	UTSW	14	31307864	missense	probably benign	0.00
R9723:Dnah1	UTSW	14	31265989	missense	probably damaging	1.00
R9758:Dnah1	UTSW	14	31263438	missense	probably damaging	0.98
RF006:Dnah1	UTSW	14	31307875	missense	probably benign	0.08
Z1088:Dnah1	UTSW	14	31304811	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGGTAGTCCCGTCTGAATGG -3'
(R):5'- TCGGGGAAGACTGTTCATGG -3'

Sequencing Primer
(F):5'- TCTGAATGGCACGATGGTCAG -3'
(R):5'- GGACATGATACGTAGGGACTTTC -3'

Posted On

2016-10-24