Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Scn8a'

436864

Institutional Source

Beutler Lab

Gene Symbol

Scn8a

Ensembl Gene

ENSMUSG00000023033

Gene Name

sodium channel, voltage-gated, type VIII, alpha

Synonyms

mnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6

MMRRC Submission

043123-MU

Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Essential gene?

Probably essential (E-score: 0.802) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100869858-101045938 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100974534 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 485 (S485P)

Ref Sequence

ENSEMBL: ENSMUSP00000143879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201518] [ENSMUST00000201549] [ENSMUST00000202702]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082209
AA Change: S485P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: S485P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	7.4e-82	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	3.5e-72	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	2.2e-57	PFAM
Pfam:Na_trans_assoc	989	1191	2e-59	PFAM
Pfam:Ion_trans	1195	1472	6.2e-69	PFAM
Pfam:Ion_trans	1519	1775	1.2e-56	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108908
AA Change: S485P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: S485P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	72	322	1.9e-76	PFAM
low complexity region	367	378	N/A	INTRINSIC
Pfam:Ion_trans	451	640	1.1e-47	PFAM
Pfam:Na_trans_assoc	655	872	1.9e-71	PFAM
Pfam:Ion_trans	898	1127	4.4e-59	PFAM
PDB:1BYY\|A	1129	1181	7e-30	PDB
Pfam:Ion_trans	1220	1429	1.9e-51	PFAM
Pfam:PKD_channel	1281	1436	5.6e-7	PFAM
IQ	1558	1580	1.2e-4	SMART
low complexity region	1619	1638	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108909
AA Change: S485P

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: S485P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	72	322	2.2e-76	PFAM
low complexity region	335	364	N/A	INTRINSIC
Pfam:DUF3451	390	616	8.7e-70	PFAM
Pfam:Ion_trans	697	886	1.3e-47	PFAM
Pfam:Na_trans_assoc	901	1118	2.3e-71	PFAM
Pfam:Ion_trans	1144	1186	9.7e-10	PFAM
Pfam:Ion_trans	1182	1332	1.7e-31	PFAM
PDB:1BYY\|A	1334	1386	2e-29	PDB
Pfam:Ion_trans	1425	1634	2.3e-51	PFAM
Pfam:PKD_channel	1486	1641	6.6e-7	PFAM
IQ	1763	1785	1.2e-4	SMART
low complexity region	1824	1843	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108910
AA Change: S485P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: S485P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	160	410	2.5e-76	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:DUF3451	478	704	9.6e-70	PFAM
Pfam:Ion_trans	785	974	1.4e-47	PFAM
Pfam:Na_trans_assoc	989	1206	2.5e-71	PFAM
Pfam:Ion_trans	1232	1461	5.7e-59	PFAM
PDB:1BYY\|A	1463	1515	4e-29	PDB
Pfam:Ion_trans	1554	1763	2.5e-51	PFAM
Pfam:PKD_channel	1615	1770	7.1e-7	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200963
AA Change: S485P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: S485P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	4.1e-80	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	2.5e-69	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	1.2e-55	PFAM
Pfam:Na_trans_assoc	989	1191	9.1e-57	PFAM
Pfam:Ion_trans	1195	1274	7.6e-16	PFAM
Pfam:Ion_trans	1270	1431	2.6e-33	PFAM
Pfam:Ion_trans	1478	1734	6.5e-55	PFAM
IQ	1851	1873	6e-7	SMART
low complexity region	1912	1931	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201518
AA Change: S485P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143879
Gene: ENSMUSG00000023033
AA Change: S485P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	8.8e-81	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	6.7e-70	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	804	5.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201549
AA Change: S485P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: S485P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	7.4e-82	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	3.5e-72	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	2.2e-57	PFAM
Pfam:Na_trans_assoc	989	1191	2e-59	PFAM
Pfam:Ion_trans	1195	1472	6.2e-69	PFAM
Pfam:Ion_trans	1519	1775	1.2e-56	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202452

Predicted Effect

probably benign
Transcript: ENSMUST00000202702
AA Change: S335P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000143876
Gene: ENSMUSG00000023033
AA Change: S335P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	272	7.9e-75	PFAM
low complexity region	273	302	N/A	INTRINSIC
Pfam:Na_trans_cytopl	349	539	9.4e-67	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202971

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Scn8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Scn8a	APN	15	100955532	unclassified	probably benign
IGL00979:Scn8a	APN	15	100955406	unclassified	probably benign
IGL01339:Scn8a	APN	15	101032201	missense	probably benign
IGL01992:Scn8a	APN	15	100969057	missense	probably damaging	1.00
IGL02215:Scn8a	APN	15	101029572	splice site	probably null
IGL02311:Scn8a	APN	15	101013283	missense	probably damaging	0.97
IGL02404:Scn8a	APN	15	101039730	missense	probably damaging	1.00
IGL02652:Scn8a	APN	15	101013476	missense	probably damaging	0.98
IGL02690:Scn8a	APN	15	100970254	missense	probably damaging	1.00
IGL02704:Scn8a	APN	15	101008062	missense	possibly damaging	0.94
IGL03084:Scn8a	APN	15	101017172	missense	probably damaging	1.00
IGL03108:Scn8a	APN	15	100974615	missense	probably benign
IGL03224:Scn8a	APN	15	101035639	missense	probably damaging	1.00
dan	UTSW	15	101035624	nonsense	probably null
nymph	UTSW	15	101035646	missense	probably damaging	1.00
Tremord	UTSW	15	101013504	missense	probably damaging	1.00
3-1:Scn8a	UTSW	15	101039939	missense	probably benign	0.04
PIT4280001:Scn8a	UTSW	15	100957489	missense	probably damaging	1.00
PIT4508001:Scn8a	UTSW	15	101029692	missense	probably damaging	0.98
R0010:Scn8a	UTSW	15	101013573	missense	probably damaging	1.00
R0010:Scn8a	UTSW	15	101013573	missense	probably damaging	1.00
R0254:Scn8a	UTSW	15	101018364	missense	probably damaging	1.00
R0412:Scn8a	UTSW	15	101008306	splice site	probably benign
R0538:Scn8a	UTSW	15	101035624	nonsense	probably null
R0539:Scn8a	UTSW	15	101016568	missense	probably damaging	1.00
R0631:Scn8a	UTSW	15	101035537	missense	probably damaging	1.00
R0726:Scn8a	UTSW	15	100972830	missense	probably damaging	1.00
R0945:Scn8a	UTSW	15	101015787	missense	possibly damaging	0.54
R0967:Scn8a	UTSW	15	101035646	missense	probably damaging	1.00
R1164:Scn8a	UTSW	15	101040162	missense	probably benign	0.06
R1283:Scn8a	UTSW	15	100969171	missense	possibly damaging	0.82
R1368:Scn8a	UTSW	15	101035541	missense	probably damaging	1.00
R1633:Scn8a	UTSW	15	101029815	missense	probably benign	0.01
R1669:Scn8a	UTSW	15	101011120	missense	probably damaging	1.00
R1694:Scn8a	UTSW	15	100955528	nonsense	probably null
R1735:Scn8a	UTSW	15	101015861	missense	possibly damaging	0.94
R1773:Scn8a	UTSW	15	101039615	missense	probably damaging	0.97
R1940:Scn8a	UTSW	15	100970204	missense	probably benign	0.22
R1996:Scn8a	UTSW	15	101024379	missense	probably damaging	1.00
R2107:Scn8a	UTSW	15	101018363	missense	probably damaging	0.99
R2251:Scn8a	UTSW	15	101017106	missense	probably benign	0.02
R2516:Scn8a	UTSW	15	100969162	missense	probably benign	0.05
R2917:Scn8a	UTSW	15	101039732	missense	probably damaging	1.00
R3417:Scn8a	UTSW	15	100971668	splice site	probably benign
R3896:Scn8a	UTSW	15	101035498	missense	probably benign
R4024:Scn8a	UTSW	15	101039793	missense	probably damaging	1.00
R4050:Scn8a	UTSW	15	101013413	nonsense	probably null
R4193:Scn8a	UTSW	15	100971603	missense	probably damaging	1.00
R4212:Scn8a	UTSW	15	100957073	missense	possibly damaging	0.88
R4358:Scn8a	UTSW	15	100940133	missense	probably benign	0.00
R4396:Scn8a	UTSW	15	100972830	missense	probably damaging	1.00
R4428:Scn8a	UTSW	15	100983903	missense	probably damaging	1.00
R4452:Scn8a	UTSW	15	100957091	missense	possibly damaging	0.95
R4631:Scn8a	UTSW	15	101016503	nonsense	probably null
R4693:Scn8a	UTSW	15	101015691	missense	probably damaging	1.00
R4765:Scn8a	UTSW	15	101040471	missense	probably benign	0.07
R4777:Scn8a	UTSW	15	101015951	missense	probably damaging	1.00
R4949:Scn8a	UTSW	15	101029782	missense	probably damaging	1.00
R4997:Scn8a	UTSW	15	100957054	missense	probably damaging	1.00
R5246:Scn8a	UTSW	15	101011057	missense	probably damaging	1.00
R5875:Scn8a	UTSW	15	100972822	nonsense	probably null
R6031:Scn8a	UTSW	15	100983984	missense	probably damaging	1.00
R6031:Scn8a	UTSW	15	100983984	missense	probably damaging	1.00
R6057:Scn8a	UTSW	15	100974667	missense	possibly damaging	0.94
R6114:Scn8a	UTSW	15	101040596	missense	probably damaging	0.99
R6362:Scn8a	UTSW	15	100940115	splice site	probably null
R6535:Scn8a	UTSW	15	100959707	intron	probably benign
R6677:Scn8a	UTSW	15	100969072	missense	probably damaging	1.00
R6687:Scn8a	UTSW	15	100974627	missense	probably benign	0.12
R6701:Scn8a	UTSW	15	101040096	missense	probably damaging	1.00
R6719:Scn8a	UTSW	15	101011015	critical splice acceptor site	probably null
R6739:Scn8a	UTSW	15	101015955	missense	possibly damaging	0.82
R6769:Scn8a	UTSW	15	101035564	missense	probably benign
R6786:Scn8a	UTSW	15	101032215	missense	probably benign	0.00
R6849:Scn8a	UTSW	15	100955587	splice site	probably null
R7108:Scn8a	UTSW	15	101039778	missense	probably benign	0.01
R7215:Scn8a	UTSW	15	101029830	missense	possibly damaging	0.80
R7217:Scn8a	UTSW	15	100970227	missense	probably benign	0.00
R7219:Scn8a	UTSW	15	100969103	missense	probably damaging	1.00
R7356:Scn8a	UTSW	15	100957579	missense	probably damaging	1.00
R7479:Scn8a	UTSW	15	100955477	missense	probably damaging	0.99
R7816:Scn8a	UTSW	15	101011036	missense	possibly damaging	0.63
R7985:Scn8a	UTSW	15	101016962	splice site	probably null
R8112:Scn8a	UTSW	15	101029837	missense	probably benign	0.27
R8263:Scn8a	UTSW	15	100983855	missense	probably damaging	1.00
R8305:Scn8a	UTSW	15	101040506	missense	probably benign	0.01
R8489:Scn8a	UTSW	15	100969133	missense	probably damaging	1.00
R8983:Scn8a	UTSW	15	101002149	missense	possibly damaging	0.81
R9034:Scn8a	UTSW	15	101029761	missense	probably damaging	0.98
R9050:Scn8a	UTSW	15	101008280	missense	possibly damaging	0.80
R9240:Scn8a	UTSW	15	101017187	nonsense	probably null
R9249:Scn8a	UTSW	15	101016575	missense	probably benign	0.00
R9462:Scn8a	UTSW	15	101032278	missense
R9599:Scn8a	UTSW	15	101013291	missense	probably damaging	1.00
R9609:Scn8a	UTSW	15	100936526	missense	possibly damaging	0.91
R9653:Scn8a	UTSW	15	101040066	missense	probably damaging	1.00
R9794:Scn8a	UTSW	15	101035451	missense	probably benign	0.00
X0066:Scn8a	UTSW	15	101040080	missense	probably damaging	1.00
X0066:Scn8a	UTSW	15	101040081	missense	probably damaging	1.00
Z1176:Scn8a	UTSW	15	101033518	missense	probably damaging	1.00
Z1177:Scn8a	UTSW	15	101040222	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCATGTCCGTGTCTGTTAG -3'
(R):5'- AGAAAGCGGGACTCTCTTGG -3'

Sequencing Primer
(F):5'- AGTGTCTGATTGGGTGGCCC -3'
(R):5'- CACAGACTTTACCTGATTCATGATGG -3'

Posted On

2016-10-24