Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Itpr3'

436870

Institutional Source

Beutler Lab

Gene Symbol

Itpr3

Ensembl Gene

ENSMUSG00000042644

Gene Name

inositol 1,4,5-triphosphate receptor 3

Synonyms

tf, Ip3r3, Itpr-3

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5566 (G1)

Quality Score

195

Status

Not validated

Chromosome

Chromosomal Location

27057304-27122223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27115952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2147 (T2147A)

Ref Sequence

ENSEMBL: ENSMUSP00000038150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049308]

AlphaFold

P70227

PDB Structure

Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049308
AA Change: T2147A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: T2147A

Domain	Start	End	E-Value	Type
MIR	113	167	7.75e-6	SMART
MIR	174	224	1.16e-4	SMART
MIR	232	288	1.21e-7	SMART
MIR	295	402	9.38e-14	SMART
Pfam:RYDR_ITPR	473	670	7.8e-64	PFAM
low complexity region	881	889	N/A	INTRINSIC
Pfam:RYDR_ITPR	1175	1333	5.8e-16	PFAM
low complexity region	1549	1567	N/A	INTRINSIC
low complexity region	1831	1851	N/A	INTRINSIC
Pfam:RIH_assoc	1863	1973	2.6e-34	PFAM
transmembrane domain	2203	2225	N/A	INTRINSIC
Pfam:Ion_trans	2235	2527	8.1e-20	PFAM
coiled coil region	2631	2660	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Itpr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Itpr3	APN	17	27083629	missense	probably benign	0.05
IGL00980:Itpr3	APN	17	27110956	missense	probably benign
IGL01151:Itpr3	APN	17	27091529	missense	probably damaging	1.00
IGL01289:Itpr3	APN	17	27099765	missense	probably damaging	0.99
IGL01403:Itpr3	APN	17	27118595	missense	probably damaging	0.97
IGL01666:Itpr3	APN	17	27117178	missense	probably benign	0.02
IGL01897:Itpr3	APN	17	27111262	missense	probably damaging	1.00
IGL02003:Itpr3	APN	17	27121475	missense	probably damaging	1.00
IGL02012:Itpr3	APN	17	27104095	missense	probably benign
IGL02063:Itpr3	APN	17	27120023	missense	probably benign	0.01
IGL02146:Itpr3	APN	17	27117275	missense	probably damaging	1.00
IGL02158:Itpr3	APN	17	27098442	missense	probably damaging	1.00
IGL02177:Itpr3	APN	17	27099614	missense	possibly damaging	0.74
IGL02247:Itpr3	APN	17	27098179	missense	probably damaging	1.00
IGL02606:Itpr3	APN	17	27114512	splice site	probably benign
IGL02651:Itpr3	APN	17	27106398	missense	probably damaging	0.99
IGL02902:Itpr3	APN	17	27104556	missense	probably benign	0.21
IGL03001:Itpr3	APN	17	27089612	splice site	probably benign
IGL03004:Itpr3	APN	17	27097978	missense	possibly damaging	0.90
IGL03065:Itpr3	APN	17	27091933	missense	probably damaging	1.00
IGL03117:Itpr3	APN	17	27119266	missense	probably damaging	1.00
IGL03181:Itpr3	APN	17	27111268	missense	probably benign
IGL03404:Itpr3	APN	17	27091518	missense	probably damaging	1.00
Allure	UTSW	17	27107303	missense	probably damaging	1.00
alopecia	UTSW	17	27095478	missense	probably damaging	0.98
Beauty	UTSW	17	27106342	missense	probably damaging	1.00
Opuesto	UTSW	17	27087592	missense	probably damaging	1.00
Paradox	UTSW	17	27098171	missense	probably damaging	1.00
Pulchritude	UTSW	17	27086960	missense	probably damaging	0.97
R0010:Itpr3	UTSW	17	27120977	missense	probably damaging	1.00
R0055:Itpr3	UTSW	17	27098322	missense	probably damaging	1.00
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0104:Itpr3	UTSW	17	27095992	missense	probably benign	0.01
R0195:Itpr3	UTSW	17	27114114	missense	probably damaging	1.00
R0212:Itpr3	UTSW	17	27089319	missense	probably damaging	1.00
R0454:Itpr3	UTSW	17	27113819	missense	probably benign
R0485:Itpr3	UTSW	17	27111929	missense	probably damaging	0.98
R0501:Itpr3	UTSW	17	27107289	missense	probably benign	0.09
R0781:Itpr3	UTSW	17	27110555	missense	probably benign	0.00
R0890:Itpr3	UTSW	17	27089011	nonsense	probably null
R1028:Itpr3	UTSW	17	27091369	missense	probably benign	0.04
R1144:Itpr3	UTSW	17	27114923	missense	probably benign	0.01
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1458:Itpr3	UTSW	17	27118372	missense	probably benign	0.01
R1463:Itpr3	UTSW	17	27117154	splice site	probably benign
R1472:Itpr3	UTSW	17	27114225	missense	probably benign	0.09
R1529:Itpr3	UTSW	17	27105485	splice site	probably null
R1533:Itpr3	UTSW	17	27095560	missense	possibly damaging	0.71
R1537:Itpr3	UTSW	17	27114147	missense	possibly damaging	0.96
R1618:Itpr3	UTSW	17	27116607	critical splice acceptor site	probably null
R1672:Itpr3	UTSW	17	27089013	missense	probably benign
R1726:Itpr3	UTSW	17	27111690	missense	probably damaging	0.96
R1865:Itpr3	UTSW	17	27120023	missense	probably benign	0.01
R1940:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R2023:Itpr3	UTSW	17	27102811	missense	possibly damaging	0.76
R2063:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2064:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2065:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2067:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2068:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2219:Itpr3	UTSW	17	27115053	missense	probably benign
R2248:Itpr3	UTSW	17	27115059	missense	probably damaging	1.00
R2291:Itpr3	UTSW	17	27113579	missense	possibly damaging	0.92
R2320:Itpr3	UTSW	17	27095915	missense	probably benign
R2864:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R2865:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R3778:Itpr3	UTSW	17	27095472	missense	possibly damaging	0.57
R3881:Itpr3	UTSW	17	27113840	missense	probably benign	0.01
R3979:Itpr3	UTSW	17	27085131	missense	probably benign	0.23
R3979:Itpr3	UTSW	17	27091572	missense	probably damaging	1.00
R4224:Itpr3	UTSW	17	27107258	missense	probably damaging	1.00
R4259:Itpr3	UTSW	17	27106324	missense	probably damaging	1.00
R4321:Itpr3	UTSW	17	27111974	missense	probably benign	0.00
R4466:Itpr3	UTSW	17	27106342	missense	probably damaging	1.00
R4493:Itpr3	UTSW	17	27104612	missense	probably damaging	1.00
R4597:Itpr3	UTSW	17	27093283	missense	probably damaging	1.00
R4823:Itpr3	UTSW	17	27085147	missense	probably benign	0.30
R4921:Itpr3	UTSW	17	27098005	missense	probably damaging	1.00
R4974:Itpr3	UTSW	17	27083608	missense	probably damaging	0.96
R5063:Itpr3	UTSW	17	27089911	missense	possibly damaging	0.94
R5079:Itpr3	UTSW	17	27098423	missense	probably damaging	1.00
R5303:Itpr3	UTSW	17	27116689	missense	probably benign	0.38
R5518:Itpr3	UTSW	17	27087592	missense	probably damaging	1.00
R5521:Itpr3	UTSW	17	27107334	missense	probably benign	0.09
R5567:Itpr3	UTSW	17	27103906	missense	possibly damaging	0.66
R5579:Itpr3	UTSW	17	27113519	missense	probably damaging	1.00
R5610:Itpr3	UTSW	17	27118566	missense	probably benign	0.42
R5658:Itpr3	UTSW	17	27107878	missense	possibly damaging	0.74
R5856:Itpr3	UTSW	17	27106405	missense	probably damaging	1.00
R5872:Itpr3	UTSW	17	27086976	missense	probably benign	0.02
R5878:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R5889:Itpr3	UTSW	17	27115065	missense	probably damaging	0.99
R5907:Itpr3	UTSW	17	27117893	missense	probably damaging	1.00
R5930:Itpr3	UTSW	17	27110921	missense	possibly damaging	0.49
R5987:Itpr3	UTSW	17	27104601	missense	probably damaging	1.00
R6029:Itpr3	UTSW	17	27098171	missense	probably damaging	1.00
R6195:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6213:Itpr3	UTSW	17	27111200	missense	probably benign	0.03
R6233:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6376:Itpr3	UTSW	17	27095475	missense	possibly damaging	0.94
R6514:Itpr3	UTSW	17	27091370	missense	probably benign
R6515:Itpr3	UTSW	17	27091370	missense	probably benign
R6516:Itpr3	UTSW	17	27091370	missense	probably benign
R6955:Itpr3	UTSW	17	27121467	missense	probably damaging	1.00
R7002:Itpr3	UTSW	17	27110580	missense	probably benign	0.00
R7064:Itpr3	UTSW	17	27089295	missense	probably damaging	1.00
R7257:Itpr3	UTSW	17	27118561	missense	probably benign	0.00
R7349:Itpr3	UTSW	17	27107812	splice site	probably null
R7469:Itpr3	UTSW	17	27121054	missense	possibly damaging	0.74
R7493:Itpr3	UTSW	17	27094800	missense	probably benign	0.09
R7510:Itpr3	UTSW	17	27089039	missense	probably damaging	0.97
R7565:Itpr3	UTSW	17	27110888	missense	probably benign	0.01
R7616:Itpr3	UTSW	17	27088977	missense	probably damaging	1.00
R7728:Itpr3	UTSW	17	27098114	missense	probably damaging	1.00
R7779:Itpr3	UTSW	17	27096063	missense	probably damaging	1.00
R7788:Itpr3	UTSW	17	27118597	nonsense	probably null
R7871:Itpr3	UTSW	17	27117179	missense	probably damaging	1.00
R7889:Itpr3	UTSW	17	27116777	missense	probably damaging	1.00
R7966:Itpr3	UTSW	17	27112028	critical splice donor site	probably null
R8065:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8067:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8230:Itpr3	UTSW	17	27107737	critical splice donor site	probably null
R8263:Itpr3	UTSW	17	27115913	nonsense	probably null
R8264:Itpr3	UTSW	17	27104112	synonymous	silent
R8269:Itpr3	UTSW	17	27093284	missense	possibly damaging	0.60
R8271:Itpr3	UTSW	17	27087648	missense	probably damaging	1.00
R8316:Itpr3	UTSW	17	27106225	missense	possibly damaging	0.50
R8354:Itpr3	UTSW	17	27115919	missense	possibly damaging	0.74
R8413:Itpr3	UTSW	17	27111926	missense	probably damaging	1.00
R8437:Itpr3	UTSW	17	27107303	missense	probably damaging	1.00
R8676:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8679:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8846:Itpr3	UTSW	17	27112022	missense	probably damaging	1.00
R8884:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8885:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8886:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8887:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8888:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8891:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8896:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8975:Itpr3	UTSW	17	27116654	missense	possibly damaging	0.56
R9025:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9026:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9063:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9087:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9088:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9089:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9090:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9091:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9200:Itpr3	UTSW	17	27107662	missense	probably damaging	0.99
R9270:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9271:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9294:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R9389:Itpr3	UTSW	17	27095925	missense	possibly damaging	0.84
R9433:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9434:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9443:Itpr3	UTSW	17	27105549	missense	probably damaging	1.00
R9472:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9474:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9475:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9476:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9477:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9507:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9508:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9511:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9694:Itpr3	UTSW	17	27115953	missense	probably damaging	0.99
R9789:Itpr3	UTSW	17	27089941	missense	probably benign	0.15
V7732:Itpr3	UTSW	17	27111024	splice site	probably benign
V7732:Itpr3	UTSW	17	27111026	splice site	probably null
Z1088:Itpr3	UTSW	17	27113528	missense	possibly damaging	0.50
Z1177:Itpr3	UTSW	17	27114929	missense	probably damaging	1.00
Z1177:Itpr3	UTSW	17	27119987	missense	probably damaging	1.00
Z31818:Itpr3	UTSW	17	27095478	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GAGAATCACACCTCGCAGATTGAG -3'
(R):5'- ACCAGTAGATGAGCGGCATG -3'

Sequencing Primer
(F):5'- CCTCGCAGATTGAGGTGAG -3'
(R):5'- GTCCCTGACGAACCCTCTG -3'

Posted On

2016-10-24