Incidental Mutation 'R5566:Xdh'
ID 436877
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 043123-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R5566 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74200617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1168 (D1168G)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: D1168G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: D1168G

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,244,615 (GRCm39) Y2159* probably null Het
Abca3 A G 17: 24,602,901 (GRCm39) T499A probably benign Het
Abcb5 T A 12: 118,899,702 (GRCm39) T322S probably damaging Het
Adamts4 T A 1: 171,078,419 (GRCm39) M1K probably null Het
Adamtsl4 C T 3: 95,592,765 (GRCm39) probably null Het
Adh4 A T 3: 138,129,950 (GRCm39) I259F probably damaging Het
Aff3 G A 1: 38,220,505 (GRCm39) S1135F probably damaging Het
Arhgef16 T C 4: 154,370,105 (GRCm39) D280G probably benign Het
Baiap3 T C 17: 25,470,707 (GRCm39) E71G probably damaging Het
Calb2 A G 8: 110,879,332 (GRCm39) I91T possibly damaging Het
Ccr5 A G 9: 123,924,697 (GRCm39) N100S probably benign Het
Cep57 G T 9: 13,732,871 (GRCm39) R25S probably damaging Het
Chadl A G 15: 81,580,079 (GRCm39) L52P probably damaging Het
Clec12b T C 6: 129,362,438 (GRCm39) T6A probably damaging Het
Cnga1 T A 5: 72,775,593 (GRCm39) N43Y probably damaging Het
Col20a1 A T 2: 180,628,316 (GRCm39) probably null Het
Csmd2 T C 4: 128,356,682 (GRCm39) probably null Het
Ctps1 A T 4: 120,411,300 (GRCm39) probably null Het
Cyp39a1 T A 17: 43,996,099 (GRCm39) W224R possibly damaging Het
Defb29 A T 2: 152,380,848 (GRCm39) Y54N probably benign Het
Dmbt1 A T 7: 130,708,003 (GRCm39) D1241V probably damaging Het
Dnah1 A T 14: 30,996,323 (GRCm39) I2671K probably benign Het
Dnah2 C A 11: 69,407,395 (GRCm39) E158* probably null Het
Dynlt2b A G 16: 32,238,718 (GRCm39) Y31C probably damaging Het
Edar A G 10: 58,464,463 (GRCm39) S59P possibly damaging Het
Egr2 T A 10: 67,376,596 (GRCm39) C339* probably null Het
Eif5b G A 1: 38,084,765 (GRCm39) V871I possibly damaging Het
Eif5b G A 1: 38,090,328 (GRCm39) G1169E probably damaging Het
Erap1 A G 13: 74,810,531 (GRCm39) Y290C probably damaging Het
Fastkd5 T A 2: 130,456,221 (GRCm39) T790S possibly damaging Het
Fkrp C T 7: 16,544,849 (GRCm39) V338M probably damaging Het
Gabra6 T C 11: 42,198,317 (GRCm39) T378A probably benign Het
Gm4924 C A 10: 82,214,475 (GRCm39) Q17K possibly damaging Het
Gm9847 A G 12: 14,545,000 (GRCm39) noncoding transcript Het
Gpr108 A G 17: 57,543,919 (GRCm39) F429S probably damaging Het
Gpr162 G A 6: 124,837,901 (GRCm39) R250* probably null Het
Gtf2a1 A T 12: 91,534,368 (GRCm39) D295E possibly damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Herc1 T A 9: 66,372,819 (GRCm39) M3125K possibly damaging Het
Hoxb6 T A 11: 96,191,580 (GRCm39) Y167* probably null Het
Hrob T A 11: 102,146,659 (GRCm39) S312T probably damaging Het
Htt T C 5: 35,006,419 (GRCm39) Y1443H probably damaging Het
Il21r A G 7: 125,224,470 (GRCm39) D28G probably damaging Het
Impact T G 18: 13,107,819 (GRCm39) V29G probably damaging Het
Itpr3 A G 17: 27,334,926 (GRCm39) T2147A possibly damaging Het
Itsn2 T A 12: 4,676,554 (GRCm39) L50Q probably damaging Het
Jade1 A G 3: 41,559,338 (GRCm39) D473G possibly damaging Het
Kif26a T G 12: 112,123,788 (GRCm39) L131R probably damaging Het
Kif2a A T 13: 107,130,432 (GRCm39) M1K probably null Het
Lrsam1 C A 2: 32,831,870 (GRCm39) Q368H probably damaging Het
Macf1 T C 4: 123,328,957 (GRCm39) Q4592R probably damaging Het
Map3k5 T C 10: 19,986,465 (GRCm39) V893A probably damaging Het
Med13l G T 5: 118,866,730 (GRCm39) V595F possibly damaging Het
Mocs1 T A 17: 49,761,211 (GRCm39) L435Q possibly damaging Het
Mtmr4 T C 11: 87,495,356 (GRCm39) L471P probably damaging Het
Myo7a T C 7: 97,714,023 (GRCm39) E1616G possibly damaging Het
Nacad T A 11: 6,552,136 (GRCm39) S352C probably damaging Het
Nfat5 T A 8: 108,095,767 (GRCm39) M817K possibly damaging Het
Ofcc1 C A 13: 40,248,129 (GRCm39) L668F probably damaging Het
Or12j2 C A 7: 139,915,980 (GRCm39) D68E probably damaging Het
Or7e178 T C 9: 20,225,265 (GRCm39) Q309R probably benign Het
Or8j3c G A 2: 86,253,721 (GRCm39) Q100* probably null Het
Plxnb2 T C 15: 89,048,223 (GRCm39) T696A probably benign Het
Prkab2 T A 3: 97,569,609 (GRCm39) F58L probably benign Het
Prpf4 G T 4: 62,334,206 (GRCm39) L220F probably benign Het
Rad18 A T 6: 112,658,307 (GRCm39) D199E probably benign Het
Raet1e T C 10: 22,050,304 (GRCm39) L29P probably damaging Het
Ralgapb A C 2: 158,336,630 (GRCm39) T1089P possibly damaging Het
Rest A G 5: 77,430,173 (GRCm39) E864G probably benign Het
Rgsl1 T A 1: 153,669,520 (GRCm39) I289F probably damaging Het
Rint1 T C 5: 24,015,951 (GRCm39) Y406H probably damaging Het
Rmc1 T C 18: 12,313,749 (GRCm39) I26T possibly damaging Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Scn8a T C 15: 100,872,415 (GRCm39) S485P probably damaging Het
Slamf1 T A 1: 171,615,538 (GRCm39) V249E possibly damaging Het
Slc39a12 C T 2: 14,412,414 (GRCm39) T362I possibly damaging Het
Sos1 C T 17: 80,761,319 (GRCm39) V126I possibly damaging Het
Srcap T C 7: 127,124,475 (GRCm39) F215S probably damaging Het
Supt4a T A 11: 87,634,113 (GRCm39) S110T probably benign Het
Tbc1d30 T A 10: 121,138,015 (GRCm39) T232S probably damaging Het
Tenm3 A G 8: 48,732,041 (GRCm39) C1288R probably damaging Het
Tespa1 T A 10: 130,191,356 (GRCm39) L100* probably null Het
Tgm1 C A 14: 55,949,893 (GRCm39) R105L probably damaging Het
Tgoln1 G A 6: 72,593,018 (GRCm39) T154I possibly damaging Het
Trp53i13 G A 11: 77,399,552 (GRCm39) T259I probably damaging Het
Tubgcp4 T A 2: 121,015,251 (GRCm39) F320I possibly damaging Het
Tut7 A T 13: 59,936,443 (GRCm39) C817* probably null Het
Vmn1r21 A C 6: 57,821,079 (GRCm39) Y122D probably benign Het
Vmn1r75 T A 7: 11,614,407 (GRCm39) D46E probably damaging Het
Vmn2r120 A T 17: 57,852,290 (GRCm39) L9M possibly damaging Het
Vmn2r59 A G 7: 41,696,247 (GRCm39) I165T possibly damaging Het
Vmn2r76 A T 7: 85,875,286 (GRCm39) Y564N probably damaging Het
Wee1 G T 7: 109,725,257 (GRCm39) E300* probably null Het
Zfp54 A G 17: 21,653,706 (GRCm39) T67A probably damaging Het
Zfp941 G T 7: 140,392,679 (GRCm39) H227N probably benign Het
Zpr1 T A 9: 46,192,373 (GRCm39) V399D possibly damaging Het
Zzz3 A G 3: 152,161,461 (GRCm39) E285G probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGGAGCAGAGTCCCACAC -3'
(R):5'- AGGGCTTACAGATTTATGGGGC -3'

Sequencing Primer
(F):5'- CTGACGCAGAAACTATGAGGCTC -3'
(R):5'- GCTTACAGATTTATGGGGCAAAAATG -3'
Posted On 2016-10-24