Mutagenetix > Incidental Mutation

Incidental Mutation 'R5567:Aqr'

436897

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

043124-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114148970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 328 (T328M)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: T328M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: T328M

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102543
AA Change: T328M

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: T328M

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184524

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	C	T	6: 86,955,168	Q374*	probably null	Het
Adam19	A	G	11: 46,136,250	D570G	probably damaging	Het
Boc	G	A	16: 44,492,824	T559I	probably damaging	Het
Cadps	A	T	14: 12,473,497	I876N	possibly damaging	Het
Cdh9	A	G	15: 16,855,844	T657A	probably damaging	Het
Cep104	T	C	4: 154,002,277	S794P	possibly damaging	Het
Cep72	T	C	13: 74,040,141	Q211R	probably benign	Het
Coq6	T	A	12: 84,368,639	D145E	probably benign	Het
Crym	T	C	7: 120,201,893	E11G	probably benign	Het
Csmd3	A	T	15: 47,645,468	M2907K	possibly damaging	Het
Cspg4	A	C	9: 56,886,648	I556L	probably benign	Het
Cwf19l2	T	A	9: 3,456,831	D721E	probably damaging	Het
Defb36	T	A	2: 152,612,583	V54E	probably damaging	Het
Dlg5	C	A	14: 24,192,913	E55*	probably null	Het
Dna2	G	T	10: 62,966,673	A857S	possibly damaging	Het
E330034G19Rik	A	G	14: 24,296,824	K60E	possibly damaging	Het
Eps8l2	G	A	7: 141,355,007	R76Q	possibly damaging	Het
Fbxl18	A	G	5: 142,895,267		probably benign	Het
Flnc	T	A	6: 29,444,045	C619*	probably null	Het
Ftcd	A	G	10: 76,588,133	K503E	probably benign	Het
Gbp2b	C	T	3: 142,611,365	A494V	possibly damaging	Het
Gfral	C	T	9: 76,208,618	A25T	probably benign	Het
Gins2	T	A	8: 120,588,945	D24V	possibly damaging	Het
Gm10985	T	C	3: 53,845,262	I22T	probably damaging	Het
Gm9992	T	C	17: 7,363,803	T456A	probably benign	Het
Golga4	T	A	9: 118,558,183	S1458T	probably damaging	Het
Gpatch1	T	C	7: 35,307,215	K176R	probably damaging	Het
Gsto1	T	C	19: 47,857,899	W62R	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gxylt1	A	G	15: 93,254,299		probably null	Het
Hs6st1	C	T	1: 36,103,638	P218L	probably benign	Het
Itpr3	C	T	17: 27,103,906	T1119M	possibly damaging	Het
Kif5c	A	G	2: 49,730,199	D226G	possibly damaging	Het
Klk1b1	T	A	7: 43,971,169	S228T	probably damaging	Het
Krt1	A	G	15: 101,846,905	F473S	probably benign	Het
Large1	A	G	8: 72,837,453	S562P	possibly damaging	Het
Lpxn	T	A	19: 12,832,659	M265K	possibly damaging	Het
Lrriq1	G	A	10: 103,170,596	P1223S	possibly damaging	Het
Map3k9	A	G	12: 81,732,024	L505P	possibly damaging	Het
Morn2	A	G	17: 80,297,280	D128G	probably damaging	Het
Msl2	A	G	9: 101,101,737	K437E	possibly damaging	Het
Msr1	T	C	8: 39,611,719	I305V	probably benign	Het
Muc4	A	G	16: 32,777,692	E3237G	possibly damaging	Het
Mxra8	T	C	4: 155,841,008	M58T	probably damaging	Het
Myo16	A	G	8: 10,322,676	D125G	probably damaging	Het
Myom2	A	G	8: 15,102,546	Q631R	probably benign	Het
Nlrp1b	T	A	11: 71,181,403	H538L	probably benign	Het
Nme3	T	A	17: 24,896,849		probably null	Het
Nop2	T	C	6: 125,133,763	S68P	probably benign	Het
Nploc4	C	T	11: 120,384,614	V499M	probably benign	Het
Nub1	A	G	5: 24,708,816	E565G	possibly damaging	Het
Olfr1012	G	A	2: 85,759,650	S242F	probably damaging	Het
Olfr378	C	T	11: 73,425,446	C179Y	probably damaging	Het
Olfr49	A	G	14: 54,282,368	F176L	probably damaging	Het
Olfr859	A	G	9: 19,808,378	D20G	probably damaging	Het
Parl	A	G	16: 20,283,012	M90T	probably damaging	Het
Pelo	T	C	13: 115,089,616	I102V	probably benign	Het
Pigt	T	A	2: 164,501,562	Y319*	probably null	Het
Plb1	A	G	5: 32,364,199	T1465A	unknown	Het
Plxna4	T	C	6: 32,157,980	N1763D	possibly damaging	Het
Pmpca	A	G	2: 26,390,541	E133G	probably damaging	Het
Pus7l	G	A	15: 94,527,865	P552S	probably benign	Het
Qsox2	A	G	2: 26,225,218	M1T	probably null	Het
Ralb	C	T	1: 119,483,535	V25I	probably damaging	Het
Rbbp6	A	G	7: 123,001,834		probably benign	Het
Rnf43	A	G	11: 87,727,445	E187G	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scap	A	G	9: 110,377,644	S386G	probably damaging	Het
Skint10	T	C	4: 112,715,870	Y243C	probably damaging	Het
Stpg2	A	G	3: 139,419,786	T447A	probably benign	Het
Tas1r1	G	A	4: 152,038,325	A21V	probably damaging	Het
Tas2r122	C	T	6: 132,711,372	G186E	probably benign	Het
Tenm4	C	A	7: 96,896,209	Y2477*	probably null	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Tmcc2	A	C	1: 132,357,805	S608A	probably benign	Het
Ttc41	T	C	10: 86,760,920		probably null	Het
Ttk	T	A	9: 83,862,535	N593K	possibly damaging	Het
Tulp1	A	G	17: 28,359,198	V289A	possibly damaging	Het
Uhrf1bp1l	T	A	10: 89,808,521	M29K	probably benign	Het
Usp34	A	C	11: 23,488,336	Q278P	probably damaging	Het
Vmn2r78	T	A	7: 86,921,529	D418E	probably benign	Het
Vmn2r90	C	T	17: 17,712,074	A81V	probably damaging	Het
Xpc	T	A	6: 91,498,135	N636I	probably damaging	Het
Zfp563	A	T	17: 33,089,457		probably benign	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TTCAGATGGACCATGAAAGTCAC -3'
(R):5'- TGGATATGCTCTCAAGTATTTGCTG -3'

Sequencing Primer
(F):5'- GTAATGAGCCTCTGAACCTGTAAGC -3'
(R):5'- GCTCTCAAGTATTTGCTGAATAATGC -3'

Posted On

2016-10-24