Mutagenetix > Incidental Mutation

Incidental Mutation 'R0046:Sis'

43690

Institutional Source

Beutler Lab

Gene Symbol

Sis

Ensembl Gene

ENSMUSG00000027790

Gene Name

sucrase isomaltase (alpha-glucosidase)

Synonyms

Si-s, sucrase-isomaltase

MMRRC Submission

038340-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72888557-72967863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 72932094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 813 (N813T)

Ref Sequence

ENSEMBL: ENSMUSP00000129116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]

AlphaFold

F8VQM5

Predicted Effect

probably benign
Transcript: ENSMUST00000094190
AA Change: N813T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: N813T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167334
AA Change: N813T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: N813T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Meta Mutation Damage Score

0.1861

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	T	4: 56,743,877	K135*	probably null	Het
Adamts16	A	G	13: 70,763,460	S871P	probably benign	Het
Adcy10	A	T	1: 165,539,834	I558F	probably damaging	Het
Adsl	T	G	15: 80,962,788		probably null	Het
Aldob	T	C	4: 49,543,842	I47V	possibly damaging	Het
Alkbh8	A	G	9: 3,343,247	E46G	probably damaging	Het
Ankrd33b	G	A	15: 31,367,337	P19L	probably damaging	Het
Apoa5	T	C	9: 46,269,998	L124S	probably damaging	Het
Atp1a4	A	T	1: 172,240,097	L533Q	probably benign	Het
Atp7b	T	C	8: 22,059,995	T9A	probably benign	Het
Auh	G	A	13: 52,929,385		probably benign	Het
B3gnt3	T	C	8: 71,692,923	Y267C	probably damaging	Het
BC051142	T	C	17: 34,460,121		probably null	Het
Card11	T	C	5: 140,908,524	T117A	possibly damaging	Het
Ccdc39	A	G	3: 33,844,152	F15L	possibly damaging	Het
Chtf18	C	T	17: 25,723,460	R468Q	probably benign	Het
Cntnap5c	T	G	17: 58,359,300	D1108E	probably benign	Het
Col14a1	G	A	15: 55,408,963		probably benign	Het
Col6a6	C	T	9: 105,748,848		probably benign	Het
Col9a3	G	A	2: 180,609,487	A317T	possibly damaging	Het
Cpt1c	A	T	7: 44,959,832		probably benign	Het
Cpt2	A	G	4: 107,904,362		probably null	Het
Crebrf	T	A	17: 26,763,334	L565M	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,782,035		noncoding transcript	Het
Dhx9	C	T	1: 153,472,707	V291M	probably benign	Het
Dmxl1	T	A	18: 49,878,082	V1102E	probably benign	Het
Dnah7a	A	T	1: 53,456,874		probably null	Het
Dock4	G	A	12: 40,737,360		probably benign	Het
Dpp3	G	T	19: 4,914,643	N545K	probably damaging	Het
Elmo2	T	A	2: 165,298,726	N275I	probably damaging	Het
Farp1	A	G	14: 121,255,513	K509R	probably benign	Het
Fat3	T	C	9: 15,965,979	Y3446C	possibly damaging	Het
Fgd2	T	A	17: 29,374,990		probably benign	Het
Flg	T	A	3: 93,277,721		probably benign	Het
Gas2l2	A	T	11: 83,421,910	W859R	probably damaging	Het
Gatm	T	C	2: 122,600,744	D254G	probably damaging	Het
Gjd4	T	A	18: 9,280,998	I27F	probably damaging	Het
Gsdmc2	C	A	15: 63,827,755		probably benign	Het
Haus5	C	T	7: 30,654,180	V591I	probably benign	Het
Kcnab3	G	A	11: 69,330,227		probably null	Het
Khdrbs2	A	G	1: 32,619,202	D281G	possibly damaging	Het
Krt86	A	T	15: 101,477,402	M393L	probably benign	Het
Limk1	T	C	5: 134,672,761	Y96C	probably damaging	Het
Lrp2bp	T	A	8: 46,013,155	Y100*	probably null	Het
Mamstr	T	G	7: 45,641,770		probably benign	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Marf1	G	A	16: 14,111,727	P1672S	possibly damaging	Het
Mboat7	T	C	7: 3,683,818	Y341C	probably damaging	Het
Nhsl1	A	T	10: 18,525,669	N881I	probably damaging	Het
Nox3	T	C	17: 3,682,961	Y225C	probably benign	Het
Nrp1	C	T	8: 128,500,608		probably benign	Het
Olfr1080	A	G	2: 86,553,632	F164S	probably damaging	Het
Olfr1214	C	T	2: 88,987,349	M284I	probably benign	Het
Olfr1260	C	T	2: 89,978,507	T243I	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr742	T	A	14: 50,516,139	*312K	probably null	Het
Pcdhb13	A	T	18: 37,444,257	M563L	probably benign	Het
Pclo	C	T	5: 14,540,479	T931M	unknown	Het
Peli2	C	T	14: 48,121,202	P16S	possibly damaging	Het
Pfas	G	T	11: 68,990,467	R1025S	probably benign	Het
Pik3c2a	A	T	7: 116,354,072	I1196N	probably damaging	Het
Pmfbp1	A	T	8: 109,535,985		probably benign	Het
Prg4	T	C	1: 150,456,086	T279A	possibly damaging	Het
Psma1	A	T	7: 114,267,205		probably benign	Het
Rab11fip1	A	G	8: 27,153,121	L550P	probably damaging	Het
Rgs12	T	A	5: 34,965,320	I149N	probably damaging	Het
Rmnd5a	T	C	6: 71,399,231	H195R	probably damaging	Het
Rnf17	T	C	14: 56,471,373	L750P	probably damaging	Het
Rtcb	T	C	10: 85,957,656	N18D	probably benign	Het
Seh1l	T	C	18: 67,792,016		probably null	Het
Sptbn2	T	C	19: 4,745,377		probably benign	Het
Stag3	C	T	5: 138,283,023		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Taok3	C	T	5: 117,272,229	Q829*	probably null	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttn	A	G	2: 76,951,542		probably benign	Het
Unc79	A	G	12: 103,125,681	E1756G	probably damaging	Het
Usp35	A	T	7: 97,313,597		probably null	Het
Vmn2r111	A	G	17: 22,548,009	F836L	probably benign	Het
Vmn2r77	A	G	7: 86,801,938	D344G	possibly damaging	Het
Zbtb40	A	G	4: 136,987,278	C1067R	probably damaging	Het

Other mutations in Sis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Sis	APN	3	72946636	missense	probably benign
IGL00715:Sis	APN	3	72934124	missense	probably damaging	1.00
IGL00721:Sis	APN	3	72943579	missense	probably damaging	1.00
IGL00766:Sis	APN	3	72907237	splice site	probably benign
IGL00783:Sis	APN	3	72946632	missense	probably benign
IGL00805:Sis	APN	3	72934199	missense	probably benign	0.05
IGL00932:Sis	APN	3	72940956	splice site	probably benign
IGL01020:Sis	APN	3	72966838	missense	probably damaging	1.00
IGL01024:Sis	APN	3	72911876	missense	probably damaging	1.00
IGL01286:Sis	APN	3	72941025	missense	probably damaging	1.00
IGL01457:Sis	APN	3	72961021	missense	probably benign
IGL01514:Sis	APN	3	72935920	splice site	probably benign
IGL01986:Sis	APN	3	72945212	missense	probably damaging	1.00
IGL02110:Sis	APN	3	72928699	nonsense	probably null
IGL02132:Sis	APN	3	72947471	missense	probably benign	0.00
IGL02152:Sis	APN	3	72888986	utr 3 prime	probably benign
IGL02200:Sis	APN	3	72943604	missense	probably damaging	0.99
IGL02244:Sis	APN	3	72956190	missense	probably benign	0.19
IGL02307:Sis	APN	3	72911834	splice site	probably benign
IGL02374:Sis	APN	3	72925456	missense	probably benign	0.03
IGL02437:Sis	APN	3	72919614	critical splice acceptor site	probably null
IGL02571:Sis	APN	3	72956304	splice site	probably benign
IGL02601:Sis	APN	3	72913210	missense	probably benign	0.44
IGL03063:Sis	APN	3	72928297	missense	probably benign
IGL03382:Sis	APN	3	72928719	missense	probably benign	0.00
IGL03397:Sis	APN	3	72935879	missense	probably benign	0.44
PIT1430001:Sis	UTSW	3	72922829	missense	probably damaging	0.97
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0094:Sis	UTSW	3	72921437	missense	probably damaging	1.00
R0096:Sis	UTSW	3	72928267	missense	probably damaging	1.00
R0505:Sis	UTSW	3	72960296	missense	probably benign	0.29
R0544:Sis	UTSW	3	72951642	missense	probably damaging	1.00
R0551:Sis	UTSW	3	72925407	missense	possibly damaging	0.79
R0617:Sis	UTSW	3	72965605	missense	probably damaging	1.00
R0698:Sis	UTSW	3	72910498	missense	probably damaging	1.00
R0701:Sis	UTSW	3	72941045	missense	probably damaging	1.00
R0704:Sis	UTSW	3	72949822	missense	possibly damaging	0.63
R0706:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0710:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0752:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0753:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0754:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0767:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0769:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0772:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0774:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0776:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0818:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0819:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0885:Sis	UTSW	3	72911949	nonsense	probably null
R1076:Sis	UTSW	3	72934098	missense	probably damaging	0.97
R1140:Sis	UTSW	3	72951616	missense	probably damaging	0.98
R1175:Sis	UTSW	3	72958104	splice site	probably benign
R1301:Sis	UTSW	3	72946582	missense	possibly damaging	0.76
R1437:Sis	UTSW	3	72934142	missense	probably damaging	1.00
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1472:Sis	UTSW	3	72889027	missense	probably benign	0.12
R1584:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1707:Sis	UTSW	3	72909087	splice site	probably benign
R1715:Sis	UTSW	3	72889010	missense	possibly damaging	0.47
R1719:Sis	UTSW	3	72965604	missense	probably damaging	1.00
R1728:Sis	UTSW	3	72965645	nonsense	probably null
R1784:Sis	UTSW	3	72965645	nonsense	probably null
R1820:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R1972:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R1973:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R2054:Sis	UTSW	3	72913237	missense	probably benign	0.01
R2233:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2235:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2276:Sis	UTSW	3	72914601	nonsense	probably null
R2435:Sis	UTSW	3	72911904	missense	probably benign	0.01
R2885:Sis	UTSW	3	72909173	missense	probably benign	0.01
R2966:Sis	UTSW	3	72889010	missense	probably benign	0.30
R3708:Sis	UTSW	3	72943523	missense	probably benign	0.02
R3790:Sis	UTSW	3	72921414	missense	probably damaging	1.00
R3807:Sis	UTSW	3	72925596	missense	probably benign	0.01
R3858:Sis	UTSW	3	72928652	missense	probably damaging	0.99
R3974:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R3975:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R4037:Sis	UTSW	3	72928602	missense	probably benign
R4080:Sis	UTSW	3	72921184	missense	probably damaging	1.00
R4204:Sis	UTSW	3	72961082	missense	probably benign
R4394:Sis	UTSW	3	72956149	missense	probably damaging	1.00
R4470:Sis	UTSW	3	72928159	splice site	probably null
R4573:Sis	UTSW	3	72928237	missense	possibly damaging	0.94
R4868:Sis	UTSW	3	72943548	missense	probably benign	0.09
R5023:Sis	UTSW	3	72934122	missense	probably benign	0.05
R5264:Sis	UTSW	3	72949756	missense	probably damaging	0.98
R5414:Sis	UTSW	3	72952493	missense	probably benign
R5462:Sis	UTSW	3	72949838	missense	probably damaging	0.96
R5523:Sis	UTSW	3	72891421	missense	probably benign	0.00
R5584:Sis	UTSW	3	72910415	missense	probably damaging	1.00
R5587:Sis	UTSW	3	72914576	missense	possibly damaging	0.94
R5725:Sis	UTSW	3	72965598	missense	probably damaging	1.00
R5769:Sis	UTSW	3	72928235	missense	probably damaging	0.98
R5790:Sis	UTSW	3	72928174	missense	probably benign
R5864:Sis	UTSW	3	72949818	missense	probably damaging	1.00
R5902:Sis	UTSW	3	72960256	critical splice donor site	probably null
R5925:Sis	UTSW	3	72921380	splice site	probably null
R6018:Sis	UTSW	3	72913192	missense	possibly damaging	0.95
R6029:Sis	UTSW	3	72928308	missense	probably benign	0.30
R6124:Sis	UTSW	3	72953211	missense	possibly damaging	0.69
R6171:Sis	UTSW	3	72961027	missense	possibly damaging	0.75
R6182:Sis	UTSW	3	72904293	missense	probably benign	0.05
R6295:Sis	UTSW	3	72966770	missense	probably damaging	0.99
R6416:Sis	UTSW	3	72911854	missense	probably damaging	1.00
R6431:Sis	UTSW	3	72958174	missense	probably benign	0.00
R6472:Sis	UTSW	3	72938734	nonsense	probably null
R6517:Sis	UTSW	3	72907142	missense	probably damaging	1.00
R6701:Sis	UTSW	3	72949527	missense	probably damaging	1.00
R6796:Sis	UTSW	3	72965618	missense	probably benign	0.06
R6853:Sis	UTSW	3	72891426	missense	possibly damaging	0.93
R6906:Sis	UTSW	3	72919485	missense	probably damaging	1.00
R7058:Sis	UTSW	3	72903607	missense	probably damaging	0.98
R7357:Sis	UTSW	3	72925071	missense	probably damaging	1.00
R7381:Sis	UTSW	3	72913292	splice site	probably null
R7439:Sis	UTSW	3	72909041	missense	possibly damaging	0.81
R7742:Sis	UTSW	3	72925098	missense	probably benign	0.19
R7813:Sis	UTSW	3	72925468	missense	probably benign	0.01
R7883:Sis	UTSW	3	72920996	missense	possibly damaging	0.78
R7899:Sis	UTSW	3	72937251	missense	probably damaging	1.00
R7915:Sis	UTSW	3	72921138	missense	probably damaging	0.99
R7985:Sis	UTSW	3	72936961	splice site	probably null
R8020:Sis	UTSW	3	72908965	critical splice donor site	probably null
R8023:Sis	UTSW	3	72952480	missense	probably damaging	0.97
R8029:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R8053:Sis	UTSW	3	72949568	nonsense	probably null
R8062:Sis	UTSW	3	72920988	nonsense	probably null
R8074:Sis	UTSW	3	72917198	missense	probably damaging	1.00
R8085:Sis	UTSW	3	72907129	missense	probably damaging	1.00
R8137:Sis	UTSW	3	72889045	missense	probably benign	0.22
R8349:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8354:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8366:Sis	UTSW	3	72958233	missense	probably damaging	1.00
R8449:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8454:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8474:Sis	UTSW	3	72929397	missense	probably damaging	1.00
R8515:Sis	UTSW	3	72929409	missense	probably benign	0.00
R8680:Sis	UTSW	3	72960295	missense	probably damaging	1.00
R8703:Sis	UTSW	3	72960324	missense	probably damaging	1.00
R9098:Sis	UTSW	3	72937245	missense	possibly damaging	0.66
R9466:Sis	UTSW	3	72965577	critical splice donor site	probably null
R9574:Sis	UTSW	3	72921157	missense	probably benign	0.05
R9630:Sis	UTSW	3	72921389	missense	probably benign	0.11
R9680:Sis	UTSW	3	72956288	missense	probably benign	0.12
R9709:Sis	UTSW	3	72891741	missense	possibly damaging	0.47
R9731:Sis	UTSW	3	72928210	missense	probably benign	0.01
X0009:Sis	UTSW	3	72889022	missense	probably damaging	0.99
X0024:Sis	UTSW	3	72928670	missense	probably benign
X0060:Sis	UTSW	3	72920906	intron	probably benign
Z1176:Sis	UTSW	3	72904273	missense	probably benign	0.05
Z1176:Sis	UTSW	3	72943557	missense	probably benign	0.25
Z1177:Sis	UTSW	3	72909172	missense	possibly damaging	0.88
Z1177:Sis	UTSW	3	72910474	missense	probably damaging	1.00
Z1177:Sis	UTSW	3	72943569	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCAGCTATTTCACAACATACCATTCACAA -3'
(R):5'- gcACTCCAAGCCAgacattcttca -3'

Sequencing Primer
(F):5'- ACCATTATGAATGGAACTTGTATGAA -3'
(R):5'- aggaagtggtagtgggtgg -3'

Posted On

2013-05-29