Incidental Mutation 'R0046:Actl7a'
ID43693
Institutional Source Beutler Lab
Gene Symbol Actl7a
Ensembl Gene ENSMUSG00000070979
Gene Nameactin-like 7a
SynonymsTact2, t-actin 2
MMRRC Submission 038340-MU
Accession Numbers

Ncbi RefSeq: NM_009611.3; MGI:1343051

Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56743413-56744925 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 56743877 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 135 (K135*)
Ref Sequence ENSEMBL: ENSMUSP00000092692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect probably null
Transcript: ENSMUST00000095079
AA Change: K135*
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979
AA Change: K135*

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095080
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Meta Mutation Damage Score 0.9705 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7A), and related gene, ACTL7B, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7A gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. The ACTL7A gene is expressed in a wide variety of adult tissues, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Actl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Actl7a APN 4 56743944 missense possibly damaging 0.86
IGL01767:Actl7a APN 4 56743980 missense probably damaging 1.00
IGL02626:Actl7a APN 4 56744353 missense possibly damaging 0.89
R0046:Actl7a UTSW 4 56743877 nonsense probably null
R1741:Actl7a UTSW 4 56744252 missense probably benign 0.03
R1920:Actl7a UTSW 4 56744135 missense probably damaging 1.00
R2984:Actl7a UTSW 4 56744531 missense probably benign 0.00
R3716:Actl7a UTSW 4 56744295 missense possibly damaging 0.67
R4779:Actl7a UTSW 4 56743632 missense probably benign 0.07
R5391:Actl7a UTSW 4 56743661 missense probably benign
R5540:Actl7a UTSW 4 56744388 missense probably benign 0.00
R5723:Actl7a UTSW 4 56744310 missense probably damaging 0.99
R5902:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R5903:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R5922:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R6010:Actl7a UTSW 4 56743870 missense possibly damaging 0.50
R6786:Actl7a UTSW 4 56744116 nonsense probably null
R7168:Actl7a UTSW 4 56743769 missense probably benign
R7568:Actl7a UTSW 4 56744498 missense probably damaging 1.00
R8230:Actl7a UTSW 4 56743768 missense probably damaging 1.00
R8305:Actl7a UTSW 4 56743744 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GACCTGCCAAGAAAGCTAGTGACC -3'
(R):5'- AAACAGCATCTCGGCGTACTTCTC -3'

Sequencing Primer
(F):5'- TCAACTATGTCCAAGGATAGGC -3'
(R):5'- ACTTCTCTCTGTTGGTATGAGGAC -3'
Posted On2013-05-29