Mutagenetix > Incidental Mutation

Incidental Mutation 'R5567:Golga4'

436936

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

043124-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118558183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1458 (S1458T)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084820
AA Change: S1458T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1458T

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000211840
AA Change: S468T

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212913

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	C	T	6: 86,955,168	Q374*	probably null	Het
Adam19	A	G	11: 46,136,250	D570G	probably damaging	Het
Aqr	G	A	2: 114,148,970	T328M	probably damaging	Het
Boc	G	A	16: 44,492,824	T559I	probably damaging	Het
Cadps	A	T	14: 12,473,497	I876N	possibly damaging	Het
Cdh9	A	G	15: 16,855,844	T657A	probably damaging	Het
Cep104	T	C	4: 154,002,277	S794P	possibly damaging	Het
Cep72	T	C	13: 74,040,141	Q211R	probably benign	Het
Coq6	T	A	12: 84,368,639	D145E	probably benign	Het
Crym	T	C	7: 120,201,893	E11G	probably benign	Het
Csmd3	A	T	15: 47,645,468	M2907K	possibly damaging	Het
Cspg4	A	C	9: 56,886,648	I556L	probably benign	Het
Cwf19l2	T	A	9: 3,456,831	D721E	probably damaging	Het
Defb36	T	A	2: 152,612,583	V54E	probably damaging	Het
Dlg5	C	A	14: 24,192,913	E55*	probably null	Het
Dna2	G	T	10: 62,966,673	A857S	possibly damaging	Het
E330034G19Rik	A	G	14: 24,296,824	K60E	possibly damaging	Het
Eps8l2	G	A	7: 141,355,007	R76Q	possibly damaging	Het
Fbxl18	A	G	5: 142,895,267		probably benign	Het
Flnc	T	A	6: 29,444,045	C619*	probably null	Het
Ftcd	A	G	10: 76,588,133	K503E	probably benign	Het
Gbp2b	C	T	3: 142,611,365	A494V	possibly damaging	Het
Gfral	C	T	9: 76,208,618	A25T	probably benign	Het
Gins2	T	A	8: 120,588,945	D24V	possibly damaging	Het
Gm10985	T	C	3: 53,845,262	I22T	probably damaging	Het
Gm9992	T	C	17: 7,363,803	T456A	probably benign	Het
Gpatch1	T	C	7: 35,307,215	K176R	probably damaging	Het
Gsto1	T	C	19: 47,857,899	W62R	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gxylt1	A	G	15: 93,254,299		probably null	Het
Hs6st1	C	T	1: 36,103,638	P218L	probably benign	Het
Itpr3	C	T	17: 27,103,906	T1119M	possibly damaging	Het
Kif5c	A	G	2: 49,730,199	D226G	possibly damaging	Het
Klk1b1	T	A	7: 43,971,169	S228T	probably damaging	Het
Krt1	A	G	15: 101,846,905	F473S	probably benign	Het
Large1	A	G	8: 72,837,453	S562P	possibly damaging	Het
Lpxn	T	A	19: 12,832,659	M265K	possibly damaging	Het
Lrriq1	G	A	10: 103,170,596	P1223S	possibly damaging	Het
Map3k9	A	G	12: 81,732,024	L505P	possibly damaging	Het
Morn2	A	G	17: 80,297,280	D128G	probably damaging	Het
Msl2	A	G	9: 101,101,737	K437E	possibly damaging	Het
Msr1	T	C	8: 39,611,719	I305V	probably benign	Het
Muc4	A	G	16: 32,777,692	E3237G	possibly damaging	Het
Mxra8	T	C	4: 155,841,008	M58T	probably damaging	Het
Myo16	A	G	8: 10,322,676	D125G	probably damaging	Het
Myom2	A	G	8: 15,102,546	Q631R	probably benign	Het
Nlrp1b	T	A	11: 71,181,403	H538L	probably benign	Het
Nme3	T	A	17: 24,896,849		probably null	Het
Nop2	T	C	6: 125,133,763	S68P	probably benign	Het
Nploc4	C	T	11: 120,384,614	V499M	probably benign	Het
Nub1	A	G	5: 24,708,816	E565G	possibly damaging	Het
Olfr1012	G	A	2: 85,759,650	S242F	probably damaging	Het
Olfr378	C	T	11: 73,425,446	C179Y	probably damaging	Het
Olfr49	A	G	14: 54,282,368	F176L	probably damaging	Het
Olfr859	A	G	9: 19,808,378	D20G	probably damaging	Het
Parl	A	G	16: 20,283,012	M90T	probably damaging	Het
Pelo	T	C	13: 115,089,616	I102V	probably benign	Het
Pigt	T	A	2: 164,501,562	Y319*	probably null	Het
Plb1	A	G	5: 32,364,199	T1465A	unknown	Het
Plxna4	T	C	6: 32,157,980	N1763D	possibly damaging	Het
Pmpca	A	G	2: 26,390,541	E133G	probably damaging	Het
Pus7l	G	A	15: 94,527,865	P552S	probably benign	Het
Qsox2	A	G	2: 26,225,218	M1T	probably null	Het
Ralb	C	T	1: 119,483,535	V25I	probably damaging	Het
Rbbp6	A	G	7: 123,001,834		probably benign	Het
Rnf43	A	G	11: 87,727,445	E187G	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scap	A	G	9: 110,377,644	S386G	probably damaging	Het
Skint10	T	C	4: 112,715,870	Y243C	probably damaging	Het
Stpg2	A	G	3: 139,419,786	T447A	probably benign	Het
Tas1r1	G	A	4: 152,038,325	A21V	probably damaging	Het
Tas2r122	C	T	6: 132,711,372	G186E	probably benign	Het
Tenm4	C	A	7: 96,896,209	Y2477*	probably null	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Tmcc2	A	C	1: 132,357,805	S608A	probably benign	Het
Ttc41	T	C	10: 86,760,920		probably null	Het
Ttk	T	A	9: 83,862,535	N593K	possibly damaging	Het
Tulp1	A	G	17: 28,359,198	V289A	possibly damaging	Het
Uhrf1bp1l	T	A	10: 89,808,521	M29K	probably benign	Het
Usp34	A	C	11: 23,488,336	Q278P	probably damaging	Het
Vmn2r78	T	A	7: 86,921,529	D418E	probably benign	Het
Vmn2r90	C	T	17: 17,712,074	A81V	probably damaging	Het
Xpc	T	A	6: 91,498,135	N636I	probably damaging	Het
Zfp563	A	T	17: 33,089,457		probably benign	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AAGTGATCTCGGTGCTCAGC -3'
(R):5'- CGCAGTCTCTAAGTCACACTC -3'

Sequencing Primer
(F):5'- ATCTCGGTGCTCAGCTGGAG -3'
(R):5'- GACTTCCATCTCGCCTTTTAAAC -3'

Posted On

2016-10-24