Incidental Mutation 'R5567:Golga4'
ID 436936
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 043124-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5567 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118387251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1458 (S1458T)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000084820
AA Change: S1458T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1458T

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211840
AA Change: S468T
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212913
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,932,150 (GRCm39) Q374* probably null Het
Adam19 A G 11: 46,027,077 (GRCm39) D570G probably damaging Het
Aqr G A 2: 113,979,451 (GRCm39) T328M probably damaging Het
Bltp3b T A 10: 89,644,383 (GRCm39) M29K probably benign Het
Boc G A 16: 44,313,187 (GRCm39) T559I probably damaging Het
Cadps A T 14: 12,473,497 (GRCm38) I876N possibly damaging Het
Cdh9 A G 15: 16,855,930 (GRCm39) T657A probably damaging Het
Cep104 T C 4: 154,086,734 (GRCm39) S794P possibly damaging Het
Cep72 T C 13: 74,188,260 (GRCm39) Q211R probably benign Het
Coq6 T A 12: 84,415,413 (GRCm39) D145E probably benign Het
Crym T C 7: 119,801,116 (GRCm39) E11G probably benign Het
Csmd3 A T 15: 47,508,864 (GRCm39) M2907K possibly damaging Het
Cspg4 A C 9: 56,793,932 (GRCm39) I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 (GRCm39) D721E probably damaging Het
Defb36 T A 2: 152,454,503 (GRCm39) V54E probably damaging Het
Dlg5 C A 14: 24,242,981 (GRCm39) E55* probably null Het
Dna2 G T 10: 62,802,452 (GRCm39) A857S possibly damaging Het
E330034G19Rik A G 14: 24,346,892 (GRCm39) K60E possibly damaging Het
Eps8l2 G A 7: 140,934,920 (GRCm39) R76Q possibly damaging Het
Fbxl18 A G 5: 142,881,022 (GRCm39) probably benign Het
Flnc T A 6: 29,444,044 (GRCm39) C619* probably null Het
Ftcd A G 10: 76,423,967 (GRCm39) K503E probably benign Het
Gbp2b C T 3: 142,317,126 (GRCm39) A494V possibly damaging Het
Gfral C T 9: 76,115,900 (GRCm39) A25T probably benign Het
Gins2 T A 8: 121,315,684 (GRCm39) D24V possibly damaging Het
Gm10985 T C 3: 53,752,683 (GRCm39) I22T probably damaging Het
Gpatch1 T C 7: 35,006,640 (GRCm39) K176R probably damaging Het
Gsto1 T C 19: 47,846,338 (GRCm39) W62R probably damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Gxylt1 A G 15: 93,152,180 (GRCm39) probably null Het
Hs6st1 C T 1: 36,142,719 (GRCm39) P218L probably benign Het
Itpr3 C T 17: 27,322,880 (GRCm39) T1119M possibly damaging Het
Kif5c A G 2: 49,620,211 (GRCm39) D226G possibly damaging Het
Klk1b1 T A 7: 43,620,593 (GRCm39) S228T probably damaging Het
Krt1 A G 15: 101,755,340 (GRCm39) F473S probably benign Het
Large1 A G 8: 73,564,081 (GRCm39) S562P possibly damaging Het
Lpxn T A 19: 12,810,023 (GRCm39) M265K possibly damaging Het
Lrriq1 G A 10: 103,006,457 (GRCm39) P1223S possibly damaging Het
Map3k9 A G 12: 81,778,798 (GRCm39) L505P possibly damaging Het
Morn2 A G 17: 80,604,709 (GRCm39) D128G probably damaging Het
Msl2 A G 9: 100,978,936 (GRCm39) K437E possibly damaging Het
Msr1 T C 8: 40,064,760 (GRCm39) I305V probably benign Het
Muc4 A G 16: 32,598,066 (GRCm39) E3237G possibly damaging Het
Mxra8 T C 4: 155,925,465 (GRCm39) M58T probably damaging Het
Myo16 A G 8: 10,372,676 (GRCm39) D125G probably damaging Het
Myom2 A G 8: 15,152,546 (GRCm39) Q631R probably benign Het
Nlrp1b T A 11: 71,072,229 (GRCm39) H538L probably benign Het
Nme3 T A 17: 25,115,823 (GRCm39) probably null Het
Nop2 T C 6: 125,110,726 (GRCm39) S68P probably benign Het
Nploc4 C T 11: 120,275,440 (GRCm39) V499M probably benign Het
Nub1 A G 5: 24,913,814 (GRCm39) E565G possibly damaging Het
Or1e19 C T 11: 73,316,272 (GRCm39) C179Y probably damaging Het
Or6e1 A G 14: 54,519,825 (GRCm39) F176L probably damaging Het
Or7e168 A G 9: 19,719,674 (GRCm39) D20G probably damaging Het
Or9g3 G A 2: 85,589,994 (GRCm39) S242F probably damaging Het
Parl A G 16: 20,101,762 (GRCm39) M90T probably damaging Het
Pelo T C 13: 115,226,152 (GRCm39) I102V probably benign Het
Pigt T A 2: 164,343,482 (GRCm39) Y319* probably null Het
Plb1 A G 5: 32,521,543 (GRCm39) T1465A unknown Het
Plxna4 T C 6: 32,134,915 (GRCm39) N1763D possibly damaging Het
Pmpca A G 2: 26,280,553 (GRCm39) E133G probably damaging Het
Pus7l G A 15: 94,425,746 (GRCm39) P552S probably benign Het
Qsox2 A G 2: 26,115,230 (GRCm39) M1T probably null Het
Ralb C T 1: 119,411,265 (GRCm39) V25I probably damaging Het
Rbbp6 A G 7: 122,601,057 (GRCm39) probably benign Het
Rnf43 A G 11: 87,618,271 (GRCm39) E187G probably damaging Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Scap A G 9: 110,206,712 (GRCm39) S386G probably damaging Het
Skint10 T C 4: 112,573,067 (GRCm39) Y243C probably damaging Het
Stpg2 A G 3: 139,125,547 (GRCm39) T447A probably benign Het
Tas1r1 G A 4: 152,122,782 (GRCm39) A21V probably damaging Het
Tas2r122 C T 6: 132,688,335 (GRCm39) G186E probably benign Het
Tenm4 C A 7: 96,545,416 (GRCm39) Y2477* probably null Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tmcc2 A C 1: 132,285,543 (GRCm39) S608A probably benign Het
Ttc41 T C 10: 86,596,784 (GRCm39) probably null Het
Ttk T A 9: 83,744,588 (GRCm39) N593K possibly damaging Het
Tulp1 A G 17: 28,578,172 (GRCm39) V289A possibly damaging Het
Unc93a2 T C 17: 7,631,202 (GRCm39) T456A probably benign Het
Usp34 A C 11: 23,438,336 (GRCm39) Q278P probably damaging Het
Vmn2r78 T A 7: 86,570,737 (GRCm39) D418E probably benign Het
Vmn2r90 C T 17: 17,932,336 (GRCm39) A81V probably damaging Het
Xpc T A 6: 91,475,117 (GRCm39) N636I probably damaging Het
Zfp563 A T 17: 33,308,431 (GRCm39) probably benign Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGTGATCTCGGTGCTCAGC -3'
(R):5'- CGCAGTCTCTAAGTCACACTC -3'

Sequencing Primer
(F):5'- ATCTCGGTGCTCAGCTGGAG -3'
(R):5'- GACTTCCATCTCGCCTTTTAAAC -3'
Posted On 2016-10-24