Incidental Mutation 'R5567:Dna2'
ID436937
Institutional Source Beutler Lab
Gene Symbol Dna2
Ensembl Gene ENSMUSG00000036875
Gene NameDNA replication helicase/nuclease 2
SynonymsE130315B21Rik, Dna2l
MMRRC Submission 043124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5567 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62947026-62974185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62966673 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 857 (A857S)
Ref Sequence ENSEMBL: ENSMUSP00000115750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092462] [ENSMUST00000131422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092462
AA Change: A857S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090119
Gene: ENSMUSG00000036875
AA Change: A857S

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 68 284 4.7e-75 PFAM
Pfam:PDDEXK_1 125 404 4.3e-13 PFAM
Pfam:AAA_11 626 799 6.7e-42 PFAM
Pfam:AAA_30 626 848 1.1e-15 PFAM
Pfam:AAA_19 633 709 5.7e-9 PFAM
Pfam:AAA_12 806 944 4.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129785
Predicted Effect possibly damaging
Transcript: ENSMUST00000131422
AA Change: A857S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115750
Gene: ENSMUSG00000036875
AA Change: A857S

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 72 283 8.2e-65 PFAM
Pfam:PDDEXK_1 125 404 3e-11 PFAM
Pfam:AAA_11 626 732 7.8e-17 PFAM
Pfam:AAA_30 626 848 1.3e-15 PFAM
Pfam:AAA_19 633 709 6.2e-9 PFAM
Pfam:AAA_11 722 799 1.2e-21 PFAM
Pfam:AAA_12 806 1020 5.3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139212
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA2/NAM7 helicase family. The encoded protein is a conserved helicase/nuclease involved in the maintenance of mitochondrial and nuclear DNA stability. Mutations in this gene are associated with autosomal dominant progressive external ophthalmoplegia-6 (PEOA6) and Seckel syndrome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E7.5. Mice heterozygous for the allele exhibit shortened telomeres, chromosome segregation errors and increased tumor incidence associated with aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,955,168 Q374* probably null Het
Adam19 A G 11: 46,136,250 D570G probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myo16 A G 8: 10,322,676 D125G probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Parl A G 16: 20,283,012 M90T probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Plxna4 T C 6: 32,157,980 N1763D possibly damaging Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Dna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dna2 APN 10 62966443 missense probably damaging 1.00
IGL00972:Dna2 APN 10 62950823 missense probably benign 0.13
IGL01511:Dna2 APN 10 62955314 missense possibly damaging 0.69
IGL01600:Dna2 APN 10 62950806 missense probably damaging 0.96
IGL02016:Dna2 APN 10 62960412 missense probably benign 0.00
IGL02049:Dna2 APN 10 62957036 missense probably damaging 0.99
IGL02069:Dna2 APN 10 62958994 missense probably benign 0.00
IGL02438:Dna2 APN 10 62957062 missense possibly damaging 0.92
IGL02743:Dna2 APN 10 62957042 missense possibly damaging 0.90
IGL02800:Dna2 APN 10 62961725 critical splice donor site probably null
IGL02936:Dna2 APN 10 62957100 missense probably damaging 1.00
supercoiled UTSW 10 62971993 splice site probably null
R0308:Dna2 UTSW 10 62956974 missense probably damaging 0.98
R0528:Dna2 UTSW 10 62958131 missense probably benign 0.00
R0669:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R0697:Dna2 UTSW 10 62949341 missense probably benign 0.01
R0831:Dna2 UTSW 10 62959329 nonsense probably null
R0839:Dna2 UTSW 10 62969782 missense probably damaging 1.00
R0991:Dna2 UTSW 10 62949187 missense probably benign 0.08
R0992:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1054:Dna2 UTSW 10 62963823 missense possibly damaging 0.84
R1082:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1084:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1184:Dna2 UTSW 10 62959198 missense probably benign 0.00
R1193:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1196:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1226:Dna2 UTSW 10 62960424 missense possibly damaging 0.88
R1561:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1562:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1566:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1568:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1598:Dna2 UTSW 10 62961657 missense probably damaging 0.99
R1768:Dna2 UTSW 10 62957084 missense probably benign 0.01
R2075:Dna2 UTSW 10 62969822 missense probably benign 0.20
R3125:Dna2 UTSW 10 62949202 missense possibly damaging 0.66
R3763:Dna2 UTSW 10 62966797 missense probably damaging 1.00
R4059:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R5002:Dna2 UTSW 10 62950842 missense probably damaging 1.00
R5160:Dna2 UTSW 10 62947154 missense probably benign
R5775:Dna2 UTSW 10 62949242 missense possibly damaging 0.94
R5984:Dna2 UTSW 10 62962506 critical splice donor site probably null
R6604:Dna2 UTSW 10 62967743 critical splice donor site probably null
R6702:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6703:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6812:Dna2 UTSW 10 62959341 missense probably benign 0.18
R6820:Dna2 UTSW 10 62964904 missense possibly damaging 0.93
R6919:Dna2 UTSW 10 62957003 missense probably damaging 1.00
R7029:Dna2 UTSW 10 62963994 missense probably damaging 1.00
R7082:Dna2 UTSW 10 62954317 missense possibly damaging 0.71
R7508:Dna2 UTSW 10 62971993 splice site probably null
R7513:Dna2 UTSW 10 62971968 missense probably benign 0.00
R7605:Dna2 UTSW 10 62960275 missense probably benign 0.02
R7742:Dna2 UTSW 10 62973294 missense probably benign 0.31
R7868:Dna2 UTSW 10 62969864 missense probably benign 0.00
R7983:Dna2 UTSW 10 62955394 missense probably benign 0.04
R8498:Dna2 UTSW 10 62973315 missense probably benign 0.12
R8508:Dna2 UTSW 10 62950894 missense probably damaging 1.00
RF007:Dna2 UTSW 10 62966695 missense probably damaging 0.99
Z1177:Dna2 UTSW 10 62962424 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCGAATGAACAGGTGTGTGC -3'
(R):5'- CTTGGTTCTAAGCAATCAGGTC -3'

Sequencing Primer
(F):5'- AACAGGTGTGTGCAGCCC -3'
(R):5'- TGGTTCTAAGCAATCAGGTCAAAAAG -3'
Posted On2016-10-24