Incidental Mutation 'R5567:Ttc41'
ID 436940
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms BC030307, Gnn
MMRRC Submission 043124-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R5567 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86541675-86612708 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 86596784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000075632
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219070
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,932,150 (GRCm39) Q374* probably null Het
Adam19 A G 11: 46,027,077 (GRCm39) D570G probably damaging Het
Aqr G A 2: 113,979,451 (GRCm39) T328M probably damaging Het
Bltp3b T A 10: 89,644,383 (GRCm39) M29K probably benign Het
Boc G A 16: 44,313,187 (GRCm39) T559I probably damaging Het
Cadps A T 14: 12,473,497 (GRCm38) I876N possibly damaging Het
Cdh9 A G 15: 16,855,930 (GRCm39) T657A probably damaging Het
Cep104 T C 4: 154,086,734 (GRCm39) S794P possibly damaging Het
Cep72 T C 13: 74,188,260 (GRCm39) Q211R probably benign Het
Coq6 T A 12: 84,415,413 (GRCm39) D145E probably benign Het
Crym T C 7: 119,801,116 (GRCm39) E11G probably benign Het
Csmd3 A T 15: 47,508,864 (GRCm39) M2907K possibly damaging Het
Cspg4 A C 9: 56,793,932 (GRCm39) I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 (GRCm39) D721E probably damaging Het
Defb36 T A 2: 152,454,503 (GRCm39) V54E probably damaging Het
Dlg5 C A 14: 24,242,981 (GRCm39) E55* probably null Het
Dna2 G T 10: 62,802,452 (GRCm39) A857S possibly damaging Het
E330034G19Rik A G 14: 24,346,892 (GRCm39) K60E possibly damaging Het
Eps8l2 G A 7: 140,934,920 (GRCm39) R76Q possibly damaging Het
Fbxl18 A G 5: 142,881,022 (GRCm39) probably benign Het
Flnc T A 6: 29,444,044 (GRCm39) C619* probably null Het
Ftcd A G 10: 76,423,967 (GRCm39) K503E probably benign Het
Gbp2b C T 3: 142,317,126 (GRCm39) A494V possibly damaging Het
Gfral C T 9: 76,115,900 (GRCm39) A25T probably benign Het
Gins2 T A 8: 121,315,684 (GRCm39) D24V possibly damaging Het
Gm10985 T C 3: 53,752,683 (GRCm39) I22T probably damaging Het
Golga4 T A 9: 118,387,251 (GRCm39) S1458T probably damaging Het
Gpatch1 T C 7: 35,006,640 (GRCm39) K176R probably damaging Het
Gsto1 T C 19: 47,846,338 (GRCm39) W62R probably damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Gxylt1 A G 15: 93,152,180 (GRCm39) probably null Het
Hs6st1 C T 1: 36,142,719 (GRCm39) P218L probably benign Het
Itpr3 C T 17: 27,322,880 (GRCm39) T1119M possibly damaging Het
Kif5c A G 2: 49,620,211 (GRCm39) D226G possibly damaging Het
Klk1b1 T A 7: 43,620,593 (GRCm39) S228T probably damaging Het
Krt1 A G 15: 101,755,340 (GRCm39) F473S probably benign Het
Large1 A G 8: 73,564,081 (GRCm39) S562P possibly damaging Het
Lpxn T A 19: 12,810,023 (GRCm39) M265K possibly damaging Het
Lrriq1 G A 10: 103,006,457 (GRCm39) P1223S possibly damaging Het
Map3k9 A G 12: 81,778,798 (GRCm39) L505P possibly damaging Het
Morn2 A G 17: 80,604,709 (GRCm39) D128G probably damaging Het
Msl2 A G 9: 100,978,936 (GRCm39) K437E possibly damaging Het
Msr1 T C 8: 40,064,760 (GRCm39) I305V probably benign Het
Muc4 A G 16: 32,598,066 (GRCm39) E3237G possibly damaging Het
Mxra8 T C 4: 155,925,465 (GRCm39) M58T probably damaging Het
Myo16 A G 8: 10,372,676 (GRCm39) D125G probably damaging Het
Myom2 A G 8: 15,152,546 (GRCm39) Q631R probably benign Het
Nlrp1b T A 11: 71,072,229 (GRCm39) H538L probably benign Het
Nme3 T A 17: 25,115,823 (GRCm39) probably null Het
Nop2 T C 6: 125,110,726 (GRCm39) S68P probably benign Het
Nploc4 C T 11: 120,275,440 (GRCm39) V499M probably benign Het
Nub1 A G 5: 24,913,814 (GRCm39) E565G possibly damaging Het
Or1e19 C T 11: 73,316,272 (GRCm39) C179Y probably damaging Het
Or6e1 A G 14: 54,519,825 (GRCm39) F176L probably damaging Het
Or7e168 A G 9: 19,719,674 (GRCm39) D20G probably damaging Het
Or9g3 G A 2: 85,589,994 (GRCm39) S242F probably damaging Het
Parl A G 16: 20,101,762 (GRCm39) M90T probably damaging Het
Pelo T C 13: 115,226,152 (GRCm39) I102V probably benign Het
Pigt T A 2: 164,343,482 (GRCm39) Y319* probably null Het
Plb1 A G 5: 32,521,543 (GRCm39) T1465A unknown Het
Plxna4 T C 6: 32,134,915 (GRCm39) N1763D possibly damaging Het
Pmpca A G 2: 26,280,553 (GRCm39) E133G probably damaging Het
Pus7l G A 15: 94,425,746 (GRCm39) P552S probably benign Het
Qsox2 A G 2: 26,115,230 (GRCm39) M1T probably null Het
Ralb C T 1: 119,411,265 (GRCm39) V25I probably damaging Het
Rbbp6 A G 7: 122,601,057 (GRCm39) probably benign Het
Rnf43 A G 11: 87,618,271 (GRCm39) E187G probably damaging Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Scap A G 9: 110,206,712 (GRCm39) S386G probably damaging Het
Skint10 T C 4: 112,573,067 (GRCm39) Y243C probably damaging Het
Stpg2 A G 3: 139,125,547 (GRCm39) T447A probably benign Het
Tas1r1 G A 4: 152,122,782 (GRCm39) A21V probably damaging Het
Tas2r122 C T 6: 132,688,335 (GRCm39) G186E probably benign Het
Tenm4 C A 7: 96,545,416 (GRCm39) Y2477* probably null Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tmcc2 A C 1: 132,285,543 (GRCm39) S608A probably benign Het
Ttk T A 9: 83,744,588 (GRCm39) N593K possibly damaging Het
Tulp1 A G 17: 28,578,172 (GRCm39) V289A possibly damaging Het
Unc93a2 T C 17: 7,631,202 (GRCm39) T456A probably benign Het
Usp34 A C 11: 23,438,336 (GRCm39) Q278P probably damaging Het
Vmn2r78 T A 7: 86,570,737 (GRCm39) D418E probably benign Het
Vmn2r90 C T 17: 17,932,336 (GRCm39) A81V probably damaging Het
Xpc T A 6: 91,475,117 (GRCm39) N636I probably damaging Het
Zfp563 A T 17: 33,308,431 (GRCm39) probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86,572,797 (GRCm39) missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86,611,821 (GRCm39) missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86,612,542 (GRCm39) missense probably benign
IGL01707:Ttc41 APN 10 86,612,631 (GRCm39) missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86,566,890 (GRCm39) missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86,612,488 (GRCm39) missense probably benign 0.03
IGL01918:Ttc41 APN 10 86,549,054 (GRCm39) missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86,611,815 (GRCm39) missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86,596,778 (GRCm39) nonsense probably null
IGL02887:Ttc41 APN 10 86,569,518 (GRCm39) missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86,572,721 (GRCm39) missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86,594,212 (GRCm39) missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86,560,278 (GRCm39) critical splice donor site probably null
IGL03242:Ttc41 APN 10 86,612,683 (GRCm39) makesense probably null
IGL03307:Ttc41 APN 10 86,580,304 (GRCm39) missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
BB013:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0379:Ttc41 UTSW 10 86,548,841 (GRCm39) missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86,599,811 (GRCm39) missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86,594,961 (GRCm39) missense probably benign 0.00
R1589:Ttc41 UTSW 10 86,612,254 (GRCm39) missense probably benign 0.01
R1599:Ttc41 UTSW 10 86,612,437 (GRCm39) missense probably benign 0.04
R1608:Ttc41 UTSW 10 86,611,857 (GRCm39) missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86,612,116 (GRCm39) missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86,612,078 (GRCm39) missense probably benign
R2398:Ttc41 UTSW 10 86,549,250 (GRCm39) missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86,560,238 (GRCm39) missense probably benign 0.42
R3117:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86,565,662 (GRCm39) missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4841:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4842:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4884:Ttc41 UTSW 10 86,566,882 (GRCm39) missense probably benign 0.00
R4885:Ttc41 UTSW 10 86,594,966 (GRCm39) missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86,612,056 (GRCm39) missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86,580,408 (GRCm39) missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86,566,806 (GRCm39) missense probably benign 0.13
R5268:Ttc41 UTSW 10 86,580,342 (GRCm39) missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86,612,443 (GRCm39) missense probably benign 0.04
R5301:Ttc41 UTSW 10 86,555,384 (GRCm39) missense probably benign 0.00
R5425:Ttc41 UTSW 10 86,612,494 (GRCm39) missense probably damaging 0.96
R5635:Ttc41 UTSW 10 86,572,841 (GRCm39) missense probably benign 0.09
R5752:Ttc41 UTSW 10 86,594,210 (GRCm39) missense probably benign 0.33
R5868:Ttc41 UTSW 10 86,586,128 (GRCm39) missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86,549,088 (GRCm39) missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86,594,952 (GRCm39) critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86,612,527 (GRCm39) missense probably benign 0.00
R6260:Ttc41 UTSW 10 86,569,571 (GRCm39) missense probably benign 0.32
R6260:Ttc41 UTSW 10 86,567,023 (GRCm39) missense probably benign 0.20
R6276:Ttc41 UTSW 10 86,580,313 (GRCm39) missense probably benign 0.01
R6458:Ttc41 UTSW 10 86,594,134 (GRCm39) missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86,549,367 (GRCm39) missense probably benign 0.17
R7348:Ttc41 UTSW 10 86,586,212 (GRCm39) nonsense probably null
R7382:Ttc41 UTSW 10 86,612,374 (GRCm39) missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86,549,296 (GRCm39) missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86,595,088 (GRCm39) missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86,612,495 (GRCm39) missense probably benign 0.02
R7926:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R7998:Ttc41 UTSW 10 86,572,711 (GRCm39) missense probably benign 0.01
R8021:Ttc41 UTSW 10 86,569,578 (GRCm39) missense probably benign
R8059:Ttc41 UTSW 10 86,548,842 (GRCm39) missense probably benign 0.01
R8170:Ttc41 UTSW 10 86,612,030 (GRCm39) missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86,555,494 (GRCm39) missense probably benign 0.06
R8375:Ttc41 UTSW 10 86,599,844 (GRCm39) missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86,555,390 (GRCm39) missense probably benign 0.00
R8698:Ttc41 UTSW 10 86,548,841 (GRCm39) missense probably benign 0.00
R8773:Ttc41 UTSW 10 86,565,679 (GRCm39) missense probably benign 0.35
R8902:Ttc41 UTSW 10 86,548,865 (GRCm39) missense probably benign 0.06
R8985:Ttc41 UTSW 10 86,566,956 (GRCm39) missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86,549,599 (GRCm39) missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86,569,625 (GRCm39) missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86,612,486 (GRCm39) missense probably benign 0.22
R9236:Ttc41 UTSW 10 86,612,594 (GRCm39) missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86,567,113 (GRCm39) missense probably benign 0.00
R9287:Ttc41 UTSW 10 86,599,830 (GRCm39) missense probably benign 0.43
R9345:Ttc41 UTSW 10 86,595,089 (GRCm39) missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86,548,890 (GRCm39) missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86,565,726 (GRCm39) missense probably benign 0.03
R9570:Ttc41 UTSW 10 86,549,598 (GRCm39) missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86,549,049 (GRCm39) missense probably benign 0.24
X0024:Ttc41 UTSW 10 86,560,114 (GRCm39) missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86,565,661 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCATGCCTGGTAAACCACAG -3'
(R):5'- TGGGTCCAGAGTTTTCAGAAGG -3'

Sequencing Primer
(F):5'- CTGGTAAACCACAGGCCTG -3'
(R):5'- GCTTTGTAGTAGATGCCCTGACAAAC -3'
Posted On 2016-10-24