Incidental Mutation 'R5567:Usp34'
ID 436943
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 043124-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.831) question?
Stock # R5567 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23438336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 278 (Q278P)
Ref Sequence ENSEMBL: ENSMUSP00000121426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000128559] [ENSMUST00000129368] [ENSMUST00000180046] [ENSMUST00000147157]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020529
SMART Domains Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 163 2.52e-57 SMART
Pfam:AHSA1 209 325 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109539
SMART Domains Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 2 115 2.33e-38 SMART
Pfam:AHSA1 161 277 4.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125701
Predicted Effect probably benign
Transcript: ENSMUST00000128372
SMART Domains Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 15 149 2.52e-57 SMART
Pfam:AHSA1 195 311 7.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128559
SMART Domains Protein: ENSMUSP00000115134
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 159 1.59e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129368
AA Change: Q278P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342
AA Change: Q278P

DomainStartEndE-ValueType
Blast:Drf_GBD 2 86 1e-19 BLAST
low complexity region 231 244 N/A INTRINSIC
coiled coil region 259 281 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: Q3390P
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: Q3390P

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180046
AA Change: Q3371P

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: Q3371P

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153409
Predicted Effect probably benign
Transcript: ENSMUST00000147157
SMART Domains Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 138 4.15e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,932,150 (GRCm39) Q374* probably null Het
Adam19 A G 11: 46,027,077 (GRCm39) D570G probably damaging Het
Aqr G A 2: 113,979,451 (GRCm39) T328M probably damaging Het
Bltp3b T A 10: 89,644,383 (GRCm39) M29K probably benign Het
Boc G A 16: 44,313,187 (GRCm39) T559I probably damaging Het
Cadps A T 14: 12,473,497 (GRCm38) I876N possibly damaging Het
Cdh9 A G 15: 16,855,930 (GRCm39) T657A probably damaging Het
Cep104 T C 4: 154,086,734 (GRCm39) S794P possibly damaging Het
Cep72 T C 13: 74,188,260 (GRCm39) Q211R probably benign Het
Coq6 T A 12: 84,415,413 (GRCm39) D145E probably benign Het
Crym T C 7: 119,801,116 (GRCm39) E11G probably benign Het
Csmd3 A T 15: 47,508,864 (GRCm39) M2907K possibly damaging Het
Cspg4 A C 9: 56,793,932 (GRCm39) I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 (GRCm39) D721E probably damaging Het
Defb36 T A 2: 152,454,503 (GRCm39) V54E probably damaging Het
Dlg5 C A 14: 24,242,981 (GRCm39) E55* probably null Het
Dna2 G T 10: 62,802,452 (GRCm39) A857S possibly damaging Het
E330034G19Rik A G 14: 24,346,892 (GRCm39) K60E possibly damaging Het
Eps8l2 G A 7: 140,934,920 (GRCm39) R76Q possibly damaging Het
Fbxl18 A G 5: 142,881,022 (GRCm39) probably benign Het
Flnc T A 6: 29,444,044 (GRCm39) C619* probably null Het
Ftcd A G 10: 76,423,967 (GRCm39) K503E probably benign Het
Gbp2b C T 3: 142,317,126 (GRCm39) A494V possibly damaging Het
Gfral C T 9: 76,115,900 (GRCm39) A25T probably benign Het
Gins2 T A 8: 121,315,684 (GRCm39) D24V possibly damaging Het
Gm10985 T C 3: 53,752,683 (GRCm39) I22T probably damaging Het
Golga4 T A 9: 118,387,251 (GRCm39) S1458T probably damaging Het
Gpatch1 T C 7: 35,006,640 (GRCm39) K176R probably damaging Het
Gsto1 T C 19: 47,846,338 (GRCm39) W62R probably damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Gxylt1 A G 15: 93,152,180 (GRCm39) probably null Het
Hs6st1 C T 1: 36,142,719 (GRCm39) P218L probably benign Het
Itpr3 C T 17: 27,322,880 (GRCm39) T1119M possibly damaging Het
Kif5c A G 2: 49,620,211 (GRCm39) D226G possibly damaging Het
Klk1b1 T A 7: 43,620,593 (GRCm39) S228T probably damaging Het
Krt1 A G 15: 101,755,340 (GRCm39) F473S probably benign Het
Large1 A G 8: 73,564,081 (GRCm39) S562P possibly damaging Het
Lpxn T A 19: 12,810,023 (GRCm39) M265K possibly damaging Het
Lrriq1 G A 10: 103,006,457 (GRCm39) P1223S possibly damaging Het
Map3k9 A G 12: 81,778,798 (GRCm39) L505P possibly damaging Het
Morn2 A G 17: 80,604,709 (GRCm39) D128G probably damaging Het
Msl2 A G 9: 100,978,936 (GRCm39) K437E possibly damaging Het
Msr1 T C 8: 40,064,760 (GRCm39) I305V probably benign Het
Muc4 A G 16: 32,598,066 (GRCm39) E3237G possibly damaging Het
Mxra8 T C 4: 155,925,465 (GRCm39) M58T probably damaging Het
Myo16 A G 8: 10,372,676 (GRCm39) D125G probably damaging Het
Myom2 A G 8: 15,152,546 (GRCm39) Q631R probably benign Het
Nlrp1b T A 11: 71,072,229 (GRCm39) H538L probably benign Het
Nme3 T A 17: 25,115,823 (GRCm39) probably null Het
Nop2 T C 6: 125,110,726 (GRCm39) S68P probably benign Het
Nploc4 C T 11: 120,275,440 (GRCm39) V499M probably benign Het
Nub1 A G 5: 24,913,814 (GRCm39) E565G possibly damaging Het
Or1e19 C T 11: 73,316,272 (GRCm39) C179Y probably damaging Het
Or6e1 A G 14: 54,519,825 (GRCm39) F176L probably damaging Het
Or7e168 A G 9: 19,719,674 (GRCm39) D20G probably damaging Het
Or9g3 G A 2: 85,589,994 (GRCm39) S242F probably damaging Het
Parl A G 16: 20,101,762 (GRCm39) M90T probably damaging Het
Pelo T C 13: 115,226,152 (GRCm39) I102V probably benign Het
Pigt T A 2: 164,343,482 (GRCm39) Y319* probably null Het
Plb1 A G 5: 32,521,543 (GRCm39) T1465A unknown Het
Plxna4 T C 6: 32,134,915 (GRCm39) N1763D possibly damaging Het
Pmpca A G 2: 26,280,553 (GRCm39) E133G probably damaging Het
Pus7l G A 15: 94,425,746 (GRCm39) P552S probably benign Het
Qsox2 A G 2: 26,115,230 (GRCm39) M1T probably null Het
Ralb C T 1: 119,411,265 (GRCm39) V25I probably damaging Het
Rbbp6 A G 7: 122,601,057 (GRCm39) probably benign Het
Rnf43 A G 11: 87,618,271 (GRCm39) E187G probably damaging Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Scap A G 9: 110,206,712 (GRCm39) S386G probably damaging Het
Skint10 T C 4: 112,573,067 (GRCm39) Y243C probably damaging Het
Stpg2 A G 3: 139,125,547 (GRCm39) T447A probably benign Het
Tas1r1 G A 4: 152,122,782 (GRCm39) A21V probably damaging Het
Tas2r122 C T 6: 132,688,335 (GRCm39) G186E probably benign Het
Tenm4 C A 7: 96,545,416 (GRCm39) Y2477* probably null Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tmcc2 A C 1: 132,285,543 (GRCm39) S608A probably benign Het
Ttc41 T C 10: 86,596,784 (GRCm39) probably null Het
Ttk T A 9: 83,744,588 (GRCm39) N593K possibly damaging Het
Tulp1 A G 17: 28,578,172 (GRCm39) V289A possibly damaging Het
Unc93a2 T C 17: 7,631,202 (GRCm39) T456A probably benign Het
Vmn2r78 T A 7: 86,570,737 (GRCm39) D418E probably benign Het
Vmn2r90 C T 17: 17,932,336 (GRCm39) A81V probably damaging Het
Xpc T A 6: 91,475,117 (GRCm39) N636I probably damaging Het
Zfp563 A T 17: 33,308,431 (GRCm39) probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAATGTTGCCTTCAGGATTTG -3'
(R):5'- TAACCTGAAACAGAGGGCAC -3'

Sequencing Primer
(F):5'- CAGGATTTGAACTCTTCCTATCTGGG -3'
(R):5'- CAGAGGGCACTGAAATCCTATTG -3'
Posted On 2016-10-24