Incidental Mutation 'R5568:Stradb'
ID436978
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene NameSTE20-related kinase adaptor beta
SynonymsAls2cr2, D1Ucla2, PRO1038
MMRRC Submission 043125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5568 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58973522-58995715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58992742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 271 (M271K)
Ref Sequence ENSEMBL: ENSMUSP00000027185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027185
AA Change: M271K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027
AA Change: M271K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054653
Predicted Effect probably benign
Transcript: ENSMUST00000114296
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123301
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147637
Predicted Effect unknown
Transcript: ENSMUST00000152318
AA Change: M114K
Predicted Effect probably benign
Transcript: ENSMUST00000153990
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Clp1 T A 2: 84,725,978 K53* probably null Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx24 T A 12: 103,424,288 Q59L possibly damaging Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Ddx58 T A 4: 40,222,140 M380L probably benign Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
Glis1 T C 4: 107,619,635 S518P probably damaging Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Nfatc1 A T 18: 80,649,822 V688D probably benign Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Ptk6 A T 2: 181,199,695 N140K possibly damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Sorcs2 A C 5: 36,046,530 Y540* probably null Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 58988529 missense probably damaging 0.98
IGL00843:Stradb APN 1 58994409 missense probably benign
IGL01288:Stradb APN 1 58992301 missense possibly damaging 0.61
IGL02045:Stradb APN 1 58989778 missense probably damaging 1.00
IGL02818:Stradb APN 1 58979962 missense probably damaging 0.99
P0047:Stradb UTSW 1 58989798 missense probably null 0.86
R0739:Stradb UTSW 1 58977015 unclassified probably benign
R0970:Stradb UTSW 1 58977060 missense possibly damaging 0.92
R1809:Stradb UTSW 1 58994390 missense possibly damaging 0.54
R1930:Stradb UTSW 1 58991105 missense probably benign 0.07
R1931:Stradb UTSW 1 58991105 missense probably benign 0.07
R1932:Stradb UTSW 1 58991105 missense probably benign 0.07
R2570:Stradb UTSW 1 58988584 missense probably damaging 1.00
R2919:Stradb UTSW 1 58992669 missense probably benign 0.44
R3104:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3105:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3106:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3772:Stradb UTSW 1 58985385 missense probably benign 0.04
R4120:Stradb UTSW 1 58980009 missense possibly damaging 0.92
R4417:Stradb UTSW 1 58994372 missense probably benign
R4569:Stradb UTSW 1 58979958 nonsense probably null
R4601:Stradb UTSW 1 58993572 missense probably damaging 0.98
R4758:Stradb UTSW 1 58988571 missense probably benign 0.02
R4786:Stradb UTSW 1 58991208 intron probably benign
R4944:Stradb UTSW 1 58980440 missense probably benign 0.27
R5113:Stradb UTSW 1 58991174 intron probably benign
R5765:Stradb UTSW 1 58992744 missense probably benign 0.31
R5970:Stradb UTSW 1 58980016 critical splice donor site probably null
R6234:Stradb UTSW 1 58988548 missense probably damaging 1.00
R7411:Stradb UTSW 1 58988518 missense possibly damaging 0.95
R7511:Stradb UTSW 1 58992949 missense probably damaging 0.97
R7569:Stradb UTSW 1 58991151 missense unknown
R7575:Stradb UTSW 1 58988580 missense probably benign 0.00
R7646:Stradb UTSW 1 58994408 missense probably benign 0.14
R7658:Stradb UTSW 1 58992726 missense probably damaging 0.96
R8306:Stradb UTSW 1 58991197 missense unknown
R8812:Stradb UTSW 1 58994319 missense probably benign 0.16
Z1176:Stradb UTSW 1 58992999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCACAAGACCTTTCTC -3'
(R):5'- GGCTATACGGAGGACCTTTCAG -3'

Sequencing Primer
(F):5'- GTGAAAGCATTTATCAGGTGGATC -3'
(R):5'- GAGGACCTTTCAGTTTCTGTAATAGC -3'
Posted On2016-10-24