Incidental Mutation 'R5568:Clp1'
ID436987
Institutional Source Beutler Lab
Gene Symbol Clp1
Ensembl Gene ENSMUSG00000027079
Gene NameCLP1, cleavage and polyadenylation factor I subunit
Synonyms
MMRRC Submission 043125-MU
Accession Numbers

Genbank: NM_133840; MGI: 2138968

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5568 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84722104-84727350 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 84725978 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 53 (K53*)
Ref Sequence ENSEMBL: ENSMUSP00000129300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028475] [ENSMUST00000165219]
Predicted Effect probably null
Transcript: ENSMUST00000028475
AA Change: K53*
SMART Domains Protein: ENSMUSP00000028475
Gene: ENSMUSG00000027079
AA Change: K53*

DomainStartEndE-ValueType
Pfam:CLP1_N 15 107 1.7e-36 PFAM
Pfam:CLP1_P 121 307 2e-79 PFAM
Pfam:Clp1 312 423 1.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138231
Predicted Effect probably null
Transcript: ENSMUST00000165219
AA Change: K53*
SMART Domains Protein: ENSMUSP00000129300
Gene: ENSMUSG00000027079
AA Change: K53*

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:MobB 115 230 5.7e-24 PFAM
Pfam:Clp1 232 424 3e-62 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Clp1 family. The encoded protein is a multifunctional kinase which is a component of the tRNA splicing endonuclease complex and a component of the pre-mRNA cleavage complex II. This protein is implicated in tRNA, mRNA, and siRNA maturation. Mutations in this gene are associated with pontocerebellar hypoplasia type 10 (PCH10). Alternatively splice transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a kinase dead allele exhibit background sensitive lethality, motor neuron degeneration, defects in diaphragm innervation, progressive muscle weakness and impaired pre-tRNA processing. Mice homozygous for a globally targeted allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx24 T A 12: 103,424,288 Q59L possibly damaging Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Ddx58 T A 4: 40,222,140 M380L probably benign Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
Glis1 T C 4: 107,619,635 S518P probably damaging Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Nfatc1 A T 18: 80,649,822 V688D probably benign Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Ptk6 A T 2: 181,199,695 N140K possibly damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Sorcs2 A C 5: 36,046,530 Y540* probably null Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Stradb T A 1: 58,992,742 M271K possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Clp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02725:Clp1 APN 2 84723864 missense probably benign 0.36
D4186:Clp1 UTSW 2 84725635 missense probably benign 0.00
R0540:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R0607:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R1954:Clp1 UTSW 2 84724051 missense probably damaging 1.00
R2908:Clp1 UTSW 2 84724144 missense possibly damaging 0.89
R4769:Clp1 UTSW 2 84725875 missense possibly damaging 0.53
R4949:Clp1 UTSW 2 84723742 missense possibly damaging 0.58
R7191:Clp1 UTSW 2 84724146 nonsense probably null
Z1177:Clp1 UTSW 2 84725963 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTACTACCATCACTCGGG -3'
(R):5'- TAATTTGGGTCCTAGGCACG -3'

Sequencing Primer
(F):5'- GGGACCTCTCTCTTCTTCCTTTTCTG -3'
(R):5'- GTCCTAGGCACGTCAGCTTTAC -3'
Posted On2016-10-24