Incidental Mutation 'R5568:Ptk6'
ID436992
Institutional Source Beutler Lab
Gene Symbol Ptk6
Ensembl Gene ENSMUSG00000038751
Gene NamePTK6 protein tyrosine kinase 6
SynonymsSik, Tksk
MMRRC Submission 043125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5568 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181193721-181202789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181199695 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 140 (N140K)
Ref Sequence ENSEMBL: ENSMUSP00000016511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016511
AA Change: N140K

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016511
Gene: ENSMUSG00000038751
AA Change: N140K

DomainStartEndE-ValueType
SH3 11 71 2e-16 SMART
SH2 76 161 1.01e-28 SMART
TyrKc 191 441 1.12e-131 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele display increased villus length in the jejunum and ileum and increased villus epithelial cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Clp1 T A 2: 84,725,978 K53* probably null Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx24 T A 12: 103,424,288 Q59L possibly damaging Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Ddx58 T A 4: 40,222,140 M380L probably benign Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
Glis1 T C 4: 107,619,635 S518P probably damaging Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Nfatc1 A T 18: 80,649,822 V688D probably benign Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Sorcs2 A C 5: 36,046,530 Y540* probably null Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Stradb T A 1: 58,992,742 M271K possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Ptk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ptk6 APN 2 181195818 missense probably benign 0.00
IGL01630:Ptk6 APN 2 181197066 missense probably damaging 0.99
IGL01862:Ptk6 APN 2 181199640 missense probably benign 0.00
IGL02231:Ptk6 APN 2 181197001 missense probably damaging 1.00
IGL02965:Ptk6 APN 2 181199068 splice site probably benign
R0115:Ptk6 UTSW 2 181202527 start gained probably benign
R0139:Ptk6 UTSW 2 181196931 splice site probably benign
R0245:Ptk6 UTSW 2 181202491 missense probably benign
R0358:Ptk6 UTSW 2 181198522 missense probably benign 0.01
R0416:Ptk6 UTSW 2 181202308 missense possibly damaging 0.94
R0454:Ptk6 UTSW 2 181202282 missense possibly damaging 0.86
R0470:Ptk6 UTSW 2 181195939 missense probably benign
R0481:Ptk6 UTSW 2 181202527 start gained probably benign
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1234:Ptk6 UTSW 2 181202440 missense possibly damaging 0.94
R2249:Ptk6 UTSW 2 181196380 missense probably benign 0.03
R4842:Ptk6 UTSW 2 181196991 missense possibly damaging 0.89
R5806:Ptk6 UTSW 2 181199730 missense possibly damaging 0.95
R6017:Ptk6 UTSW 2 181195812 missense probably benign 0.32
R6285:Ptk6 UTSW 2 181197093 missense probably null 1.00
R6293:Ptk6 UTSW 2 181198460 missense probably damaging 1.00
R6468:Ptk6 UTSW 2 181199102 missense probably benign
R7369:Ptk6 UTSW 2 181198461 missense possibly damaging 0.86
X0062:Ptk6 UTSW 2 181202323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATAGCCAAGGAGATTGCCC -3'
(R):5'- CCGGAAACAGAGTAGCCATG -3'

Sequencing Primer
(F):5'- AAGGAGATTGCCCTGTCCTG -3'
(R):5'- CCATGGCTTATGACAGGAGTGC -3'
Posted On2016-10-24