Incidental Mutation 'R5568:Ddx58'
ID436995
Institutional Source Beutler Lab
Gene Symbol Ddx58
Ensembl Gene ENSMUSG00000040296
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 58
SynonymsRIG-I, 6430573D20Rik
MMRRC Submission 043125-MU
Accession Numbers

Genbank: NM_172689; MGI:2442858

Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R5568 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location40203773-40239828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40222140 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 380 (M380L)
Ref Sequence ENSEMBL: ENSMUSP00000115052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037907] [ENSMUST00000142055]
Predicted Effect probably benign
Transcript: ENSMUST00000037907
AA Change: M425L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042433
Gene: ENSMUSG00000040296
AA Change: M425L

DomainStartEndE-ValueType
Pfam:CARD_2 1 93 1.2e-31 PFAM
Pfam:CARD_2 99 189 6.2e-28 PFAM
DEXDc 240 453 8.61e-26 SMART
low complexity region 582 600 N/A INTRINSIC
HELICc 642 735 1.32e-12 SMART
Pfam:RIG-I_C-RD 807 924 4.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139583
Predicted Effect probably benign
Transcript: ENSMUST00000142055
AA Change: M380L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296
AA Change: M380L

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149539
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null allele die in utero with liver apoptosis while survivors show impaired IFN induction and succumb to infection with certain RNA viruses. Homozygotes for another null allele are viable but develop colitis and progressive granulocytosis leading to chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Gene trapped(7)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Clp1 T A 2: 84,725,978 K53* probably null Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx24 T A 12: 103,424,288 Q59L possibly damaging Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
Glis1 T C 4: 107,619,635 S518P probably damaging Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Nfatc1 A T 18: 80,649,822 V688D probably benign Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Ptk6 A T 2: 181,199,695 N140K possibly damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Sorcs2 A C 5: 36,046,530 Y540* probably null Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Stradb T A 1: 58,992,742 M271K possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Ddx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ddx58 APN 4 40220389 splice site probably benign
IGL01344:Ddx58 APN 4 40208883 missense probably damaging 0.99
IGL01414:Ddx58 APN 4 40222176 missense probably damaging 1.00
IGL01529:Ddx58 APN 4 40225685 missense probably benign
IGL01756:Ddx58 APN 4 40209934 missense probably damaging 1.00
IGL02023:Ddx58 APN 4 40216487 missense possibly damaging 0.76
IGL02223:Ddx58 APN 4 40209993 missense possibly damaging 0.48
IGL02458:Ddx58 APN 4 40229536 missense probably damaging 0.98
IGL02937:Ddx58 APN 4 40229661 missense probably benign 0.00
IGL03358:Ddx58 APN 4 40206069 missense possibly damaging 0.54
E2594:Ddx58 UTSW 4 40235282 nonsense probably null
R0324:Ddx58 UTSW 4 40213766 missense probably benign 0.24
R0400:Ddx58 UTSW 4 40235257 missense probably benign 0.00
R0518:Ddx58 UTSW 4 40216354 critical splice donor site probably null
R0834:Ddx58 UTSW 4 40239596 missense possibly damaging 0.64
R1474:Ddx58 UTSW 4 40208868 missense possibly damaging 0.62
R1611:Ddx58 UTSW 4 40223862 missense probably damaging 1.00
R1803:Ddx58 UTSW 4 40224013 missense probably benign 0.00
R1906:Ddx58 UTSW 4 40206054 missense probably benign 0.01
R2072:Ddx58 UTSW 4 40224069 splice site probably null
R4696:Ddx58 UTSW 4 40203798 unclassified probably benign
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R5027:Ddx58 UTSW 4 40208845 missense probably benign
R6144:Ddx58 UTSW 4 40229551 missense probably benign 0.21
R6341:Ddx58 UTSW 4 40222199 critical splice acceptor site probably null
R6373:Ddx58 UTSW 4 40216487 missense possibly damaging 0.76
R6454:Ddx58 UTSW 4 40220456 missense probably damaging 0.99
R6456:Ddx58 UTSW 4 40213838 missense possibly damaging 0.73
R6523:Ddx58 UTSW 4 40205947 missense probably benign 0.00
R6593:Ddx58 UTSW 4 40226651 missense probably benign 0.02
R6741:Ddx58 UTSW 4 40211624 missense probably damaging 1.00
R6964:Ddx58 UTSW 4 40225697 missense probably benign 0.00
R7149:Ddx58 UTSW 4 40222079 missense possibly damaging 0.64
R7159:Ddx58 UTSW 4 40213804 missense probably benign 0.29
R7237:Ddx58 UTSW 4 40205938 missense probably benign 0.10
R7352:Ddx58 UTSW 4 40239668 missense probably benign 0.00
R7356:Ddx58 UTSW 4 40226600 missense probably benign 0.01
R7611:Ddx58 UTSW 4 40225651 missense probably damaging 1.00
R7615:Ddx58 UTSW 4 40229653 missense possibly damaging 0.59
R7729:Ddx58 UTSW 4 40206034 missense possibly damaging 0.53
R7759:Ddx58 UTSW 4 40225104 missense probably damaging 1.00
R7800:Ddx58 UTSW 4 40211618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ATCCACTGTCTCTGACGCAG -3'
(R):5'- TGAATGAGCCTGGAATGGAC -3'

Sequencing Primer
(F):5'- TCTGACGCAGAGGGGAC -3'
(R):5'- TAGCCCTGCCTGGAAAGGTTTC -3'
Posted On2016-10-24