Incidental Mutation 'R5568:Glis1'
ID 436999
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene Name GLIS family zinc finger 1
Synonyms GliH1
MMRRC Submission 043125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5568 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 107434591-107635061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107619635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 518 (S518P)
Ref Sequence ENSEMBL: ENSMUSP00000035650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]
AlphaFold Q8K1M4
Predicted Effect probably damaging
Transcript: ENSMUST00000046005
AA Change: S518P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: S518P

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106738
AA Change: S330P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: S330P

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138211
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Clp1 T A 2: 84,725,978 K53* probably null Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx24 T A 12: 103,424,288 Q59L possibly damaging Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Ddx58 T A 4: 40,222,140 M380L probably benign Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Nfatc1 A T 18: 80,649,822 V688D probably benign Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Ptk6 A T 2: 181,199,695 N140K possibly damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Sorcs2 A C 5: 36,046,530 Y540* probably null Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Stradb T A 1: 58,992,742 M271K possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107627561 missense probably benign 0.01
IGL02450:Glis1 APN 4 107627529 missense probably benign 0.25
IGL03167:Glis1 APN 4 107435905 missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107615051 missense probably damaging 1.00
IGL03377:Glis1 APN 4 107632281 missense probably damaging 0.98
glenys UTSW 4 107627543 missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107568119 splice site probably null
R0981:Glis1 UTSW 4 107615042 missense probably damaging 1.00
R1036:Glis1 UTSW 4 107632264 missense probably benign 0.05
R1527:Glis1 UTSW 4 107567926 missense probably damaging 0.96
R1741:Glis1 UTSW 4 107568347 missense probably damaging 1.00
R2937:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107567845 missense probably benign 0.01
R4412:Glis1 UTSW 4 107634718 missense probably damaging 0.99
R4587:Glis1 UTSW 4 107627543 missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107567645 missense probably benign 0.00
R4900:Glis1 UTSW 4 107619564 missense probably damaging 1.00
R5138:Glis1 UTSW 4 107623105 frame shift probably null
R5167:Glis1 UTSW 4 107634694 missense probably damaging 1.00
R5511:Glis1 UTSW 4 107435877 missense probably damaging 0.99
R5807:Glis1 UTSW 4 107568082 missense probably benign 0.00
R6006:Glis1 UTSW 4 107567906 missense probably damaging 1.00
R6180:Glis1 UTSW 4 107627513 missense probably benign 0.06
R6219:Glis1 UTSW 4 107631905 missense probably benign 0.27
R6856:Glis1 UTSW 4 107435879 missense probably damaging 0.96
R7278:Glis1 UTSW 4 107435683 start codon destroyed probably null 0.53
R7877:Glis1 UTSW 4 107634703 missense probably damaging 1.00
R7937:Glis1 UTSW 4 107627526 missense possibly damaging 0.68
R7940:Glis1 UTSW 4 107632374 missense probably damaging 1.00
R7940:Glis1 UTSW 4 107632375 missense probably damaging 0.99
R7954:Glis1 UTSW 4 107619657 missense possibly damaging 0.82
R8078:Glis1 UTSW 4 107567902 missense probably damaging 1.00
R8931:Glis1 UTSW 4 107563863 missense probably benign 0.35
R9227:Glis1 UTSW 4 107568130 missense probably benign 0.45
R9230:Glis1 UTSW 4 107568130 missense probably benign 0.45
R9767:Glis1 UTSW 4 107634597 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTAGCCTTCAGACTGCAGC -3'
(R):5'- TATACTGACTGGTTGGGAGAAAGAC -3'

Sequencing Primer
(F):5'- TTCAGACTGCAGCCTGCC -3'
(R):5'- CTGGTTGGGAGAAAGACATGGG -3'
Posted On 2016-10-24