Mutagenetix > Incidental Mutation

Incidental Mutation 'R0046:Stag3'

43700

Institutional Source

Beutler Lab

Gene Symbol

Stag3

Ensembl Gene

ENSMUSG00000036928

Gene Name

stromal antigen 3

Synonyms

SA-2, stromalin 3

MMRRC Submission

038340-MU

Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0046 (G1)

Quality Score

123

Status

Validated

Chromosome

Chromosomal Location

138280240-138312393 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 138283023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014089] [ENSMUST00000048028] [ENSMUST00000159067] [ENSMUST00000160729] [ENSMUST00000161691] [ENSMUST00000161827] [ENSMUST00000161984] [ENSMUST00000162245]

AlphaFold

O70576

Predicted Effect

probably benign
Transcript: ENSMUST00000014089

SMART Domains

Protein: ENSMUSP00000014089
Gene: ENSMUSG00000029510

Domain	Start	End	E-Value	Type
Pfam:Glypican	7	560	2.8e-186	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000048028

SMART Domains

Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
Pfam:STAG	188	301	3.1e-38	PFAM
low complexity region	633	653	N/A	INTRINSIC
low complexity region	1099	1114	N/A	INTRINSIC
low complexity region	1141	1151	N/A	INTRINSIC
low complexity region	1190	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159067

SMART Domains

Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

Domain	Start	End	E-Value	Type
Pfam:Glypican	7	250	1e-90	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159350

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159483

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159689

Predicted Effect

probably benign
Transcript: ENSMUST00000160729

SMART Domains

Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161055

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161113

Predicted Effect

probably benign
Transcript: ENSMUST00000161691

SMART Domains

Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

Domain	Start	End	E-Value	Type
low complexity region	44	59	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161827

SMART Domains

Protein: ENSMUSP00000124459
Gene: ENSMUSG00000029510

Domain	Start	End	E-Value	Type
Pfam:Glypican	11	566	3.1e-199	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161984

SMART Domains

Protein: ENSMUSP00000137879
Gene: ENSMUSG00000029510

Domain	Start	End	E-Value	Type
Pfam:Glypican	7	342	3.7e-134	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162245

SMART Domains

Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
Pfam:STAG	185	304	4e-50	PFAM
low complexity region	633	653	N/A	INTRINSIC
low complexity region	1099	1114	N/A	INTRINSIC
low complexity region	1141	1151	N/A	INTRINSIC
low complexity region	1190	1208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162909

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	T	4: 56,743,877	K135*	probably null	Het
Adamts16	A	G	13: 70,763,460	S871P	probably benign	Het
Adcy10	A	T	1: 165,539,834	I558F	probably damaging	Het
Adsl	T	G	15: 80,962,788		probably null	Het
Aldob	T	C	4: 49,543,842	I47V	possibly damaging	Het
Alkbh8	A	G	9: 3,343,247	E46G	probably damaging	Het
Ankrd33b	G	A	15: 31,367,337	P19L	probably damaging	Het
Apoa5	T	C	9: 46,269,998	L124S	probably damaging	Het
Atp1a4	A	T	1: 172,240,097	L533Q	probably benign	Het
Atp7b	T	C	8: 22,059,995	T9A	probably benign	Het
Auh	G	A	13: 52,929,385		probably benign	Het
B3gnt3	T	C	8: 71,692,923	Y267C	probably damaging	Het
BC051142	T	C	17: 34,460,121		probably null	Het
Card11	T	C	5: 140,908,524	T117A	possibly damaging	Het
Ccdc39	A	G	3: 33,844,152	F15L	possibly damaging	Het
Chtf18	C	T	17: 25,723,460	R468Q	probably benign	Het
Cntnap5c	T	G	17: 58,359,300	D1108E	probably benign	Het
Col14a1	G	A	15: 55,408,963		probably benign	Het
Col6a6	C	T	9: 105,748,848		probably benign	Het
Col9a3	G	A	2: 180,609,487	A317T	possibly damaging	Het
Cpt1c	A	T	7: 44,959,832		probably benign	Het
Cpt2	A	G	4: 107,904,362		probably null	Het
Crebrf	T	A	17: 26,763,334	L565M	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,782,035		noncoding transcript	Het
Dhx9	C	T	1: 153,472,707	V291M	probably benign	Het
Dmxl1	T	A	18: 49,878,082	V1102E	probably benign	Het
Dnah7a	A	T	1: 53,456,874		probably null	Het
Dock4	G	A	12: 40,737,360		probably benign	Het
Dpp3	G	T	19: 4,914,643	N545K	probably damaging	Het
Elmo2	T	A	2: 165,298,726	N275I	probably damaging	Het
Farp1	A	G	14: 121,255,513	K509R	probably benign	Het
Fat3	T	C	9: 15,965,979	Y3446C	possibly damaging	Het
Fgd2	T	A	17: 29,374,990		probably benign	Het
Flg	T	A	3: 93,277,721		probably benign	Het
Gas2l2	A	T	11: 83,421,910	W859R	probably damaging	Het
Gatm	T	C	2: 122,600,744	D254G	probably damaging	Het
Gjd4	T	A	18: 9,280,998	I27F	probably damaging	Het
Gsdmc2	C	A	15: 63,827,755		probably benign	Het
Haus5	C	T	7: 30,654,180	V591I	probably benign	Het
Kcnab3	G	A	11: 69,330,227		probably null	Het
Khdrbs2	A	G	1: 32,619,202	D281G	possibly damaging	Het
Krt86	A	T	15: 101,477,402	M393L	probably benign	Het
Limk1	T	C	5: 134,672,761	Y96C	probably damaging	Het
Lrp2bp	T	A	8: 46,013,155	Y100*	probably null	Het
Mamstr	T	G	7: 45,641,770		probably benign	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Marf1	G	A	16: 14,111,727	P1672S	possibly damaging	Het
Mboat7	T	C	7: 3,683,818	Y341C	probably damaging	Het
Nhsl1	A	T	10: 18,525,669	N881I	probably damaging	Het
Nox3	T	C	17: 3,682,961	Y225C	probably benign	Het
Nrp1	C	T	8: 128,500,608		probably benign	Het
Olfr1080	A	G	2: 86,553,632	F164S	probably damaging	Het
Olfr1214	C	T	2: 88,987,349	M284I	probably benign	Het
Olfr1260	C	T	2: 89,978,507	T243I	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr742	T	A	14: 50,516,139	*312K	probably null	Het
Pcdhb13	A	T	18: 37,444,257	M563L	probably benign	Het
Pclo	C	T	5: 14,540,479	T931M	unknown	Het
Peli2	C	T	14: 48,121,202	P16S	possibly damaging	Het
Pfas	G	T	11: 68,990,467	R1025S	probably benign	Het
Pik3c2a	A	T	7: 116,354,072	I1196N	probably damaging	Het
Pmfbp1	A	T	8: 109,535,985		probably benign	Het
Prg4	T	C	1: 150,456,086	T279A	possibly damaging	Het
Psma1	A	T	7: 114,267,205		probably benign	Het
Rab11fip1	A	G	8: 27,153,121	L550P	probably damaging	Het
Rgs12	T	A	5: 34,965,320	I149N	probably damaging	Het
Rmnd5a	T	C	6: 71,399,231	H195R	probably damaging	Het
Rnf17	T	C	14: 56,471,373	L750P	probably damaging	Het
Rtcb	T	C	10: 85,957,656	N18D	probably benign	Het
Seh1l	T	C	18: 67,792,016		probably null	Het
Sis	T	G	3: 72,932,094	N813T	probably benign	Het
Sptbn2	T	C	19: 4,745,377		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Taok3	C	T	5: 117,272,229	Q829*	probably null	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttn	A	G	2: 76,951,542		probably benign	Het
Unc79	A	G	12: 103,125,681	E1756G	probably damaging	Het
Usp35	A	T	7: 97,313,597		probably null	Het
Vmn2r111	A	G	17: 22,548,009	F836L	probably benign	Het
Vmn2r77	A	G	7: 86,801,938	D344G	possibly damaging	Het
Zbtb40	A	G	4: 136,987,278	C1067R	probably damaging	Het

Other mutations in Stag3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Stag3	APN	5	138299138	missense	probably damaging	1.00
IGL00336:Stag3	APN	5	138297659	missense	probably benign	0.42
IGL00514:Stag3	APN	5	138300135	missense	probably damaging	1.00
IGL00961:Stag3	APN	5	138298349	missense	probably benign	0.01
IGL01923:Stag3	APN	5	138289230	missense	probably damaging	1.00
IGL02252:Stag3	APN	5	138302548	missense	probably damaging	1.00
IGL02424:Stag3	APN	5	138281985	nonsense	probably null
IGL02424:Stag3	APN	5	138291366	missense	probably damaging	1.00
IGL02869:Stag3	APN	5	138282693	missense	probably damaging	0.96
thor	UTSW	5	138301036	critical splice donor site	probably null
R0016:Stag3	UTSW	5	138291381	missense	possibly damaging	0.50
R0038:Stag3	UTSW	5	138301036	critical splice donor site	probably null
R0038:Stag3	UTSW	5	138301036	critical splice donor site	probably null
R0046:Stag3	UTSW	5	138283023	splice site	probably benign
R1455:Stag3	UTSW	5	138311735	missense	probably benign	0.00
R1512:Stag3	UTSW	5	138297985	missense	probably benign	0.32
R1530:Stag3	UTSW	5	138297412	missense	probably damaging	0.99
R1608:Stag3	UTSW	5	138298639	splice site	probably null
R1736:Stag3	UTSW	5	138304509	splice site	probably benign
R1969:Stag3	UTSW	5	138300138	missense	probably damaging	0.99
R2034:Stag3	UTSW	5	138298001	missense	possibly damaging	0.82
R2214:Stag3	UTSW	5	138301266	missense	possibly damaging	0.92
R2281:Stag3	UTSW	5	138298284	missense	probably damaging	1.00
R2411:Stag3	UTSW	5	138283028	splice site	probably benign
R3792:Stag3	UTSW	5	138298349	missense	probably benign	0.01
R3887:Stag3	UTSW	5	138298839	missense	probably damaging	0.99
R4255:Stag3	UTSW	5	138290881	missense	probably damaging	0.98
R4777:Stag3	UTSW	5	138309199	unclassified	probably benign
R4842:Stag3	UTSW	5	138309365	splice site	probably null
R4854:Stag3	UTSW	5	138296694	splice site	probably null
R5045:Stag3	UTSW	5	138304478	missense	probably damaging	1.00
R5631:Stag3	UTSW	5	138295877	missense	probably damaging	0.96
R5729:Stag3	UTSW	5	138290223	missense	possibly damaging	0.76
R5894:Stag3	UTSW	5	138298838	missense	probably damaging	0.99
R6004:Stag3	UTSW	5	138289206	missense	probably damaging	1.00
R6172:Stag3	UTSW	5	138299843	missense	probably benign	0.41
R6503:Stag3	UTSW	5	138304420	missense	probably damaging	0.96
R6545:Stag3	UTSW	5	138298352	missense	possibly damaging	0.84
R6736:Stag3	UTSW	5	138301499	missense	probably damaging	0.98
R6861:Stag3	UTSW	5	138304707	missense	possibly damaging	0.55
R7012:Stag3	UTSW	5	138297609	splice site	probably null
R7358:Stag3	UTSW	5	138301508	missense	probably damaging	1.00
R7378:Stag3	UTSW	5	138281960	missense	probably benign	0.00
R7392:Stag3	UTSW	5	138291366	missense	probably damaging	1.00
R7395:Stag3	UTSW	5	138281945	missense	probably benign	0.33
R7818:Stag3	UTSW	5	138301443	missense	probably benign	0.00
R8017:Stag3	UTSW	5	138301203	missense	possibly damaging	0.80
R8019:Stag3	UTSW	5	138301203	missense	possibly damaging	0.80
R8076:Stag3	UTSW	5	138283142	missense	probably damaging	0.96
R8393:Stag3	UTSW	5	138296755	missense	probably damaging	0.98
R8405:Stag3	UTSW	5	138304652	missense	probably damaging	0.99
R8417:Stag3	UTSW	5	138308588	missense	probably benign
R8734:Stag3	UTSW	5	138311788	missense	probably benign	0.36
R8848:Stag3	UTSW	5	138290266	missense	probably null	0.97
R8966:Stag3	UTSW	5	138291404	missense	probably damaging	0.99
R9029:Stag3	UTSW	5	138298034	missense	probably damaging	1.00
R9292:Stag3	UTSW	5	138301450	missense	probably benign	0.01
R9410:Stag3	UTSW	5	138299339	missense	possibly damaging	0.95
R9645:Stag3	UTSW	5	138301439	missense	possibly damaging	0.78
R9723:Stag3	UTSW	5	138299841	missense	probably benign
Z1177:Stag3	UTSW	5	138301292	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- AAACCTGGAAGGGACTCAGGTGAT -3'
(R):5'- ACCAACCTGTGTGGTATTTATGCCAA -3'

Sequencing Primer
(F):5'- GGGACTCAGGTGATGGAATG -3'
(R):5'- TCCAGGTAGTAAGACTTATACATGG -3'

Posted On

2013-05-29