Incidental Mutation 'R0046:Stag3'
ID 43700
Institutional Source Beutler Lab
Gene Symbol Stag3
Ensembl Gene ENSMUSG00000036928
Gene Name STAG3 cohesin complex component
Synonyms SA-2, stromalin 3
MMRRC Submission 038340-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0046 (G1)
Quality Score 123
Status Validated
Chromosome 5
Chromosomal Location 138278502-138310655 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 138281285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014089] [ENSMUST00000048028] [ENSMUST00000159067] [ENSMUST00000160729] [ENSMUST00000162245] [ENSMUST00000161691] [ENSMUST00000161984] [ENSMUST00000161827]
AlphaFold O70576
Predicted Effect probably benign
Transcript: ENSMUST00000014089
SMART Domains Protein: ENSMUSP00000014089
Gene: ENSMUSG00000029510

DomainStartEndE-ValueType
Pfam:Glypican 7 560 2.8e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048028
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159689
Predicted Effect probably benign
Transcript: ENSMUST00000160729
SMART Domains Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162245
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably benign
Transcript: ENSMUST00000161691
SMART Domains Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161055
Predicted Effect probably benign
Transcript: ENSMUST00000161984
SMART Domains Protein: ENSMUSP00000137879
Gene: ENSMUSG00000029510

DomainStartEndE-ValueType
Pfam:Glypican 7 342 3.7e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161827
SMART Domains Protein: ENSMUSP00000124459
Gene: ENSMUSG00000029510

DomainStartEndE-ValueType
Pfam:Glypican 11 566 3.1e-199 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 (GRCm39) K135* probably null Het
Adamts16 A G 13: 70,911,579 (GRCm39) S871P probably benign Het
Adcy10 A T 1: 165,367,403 (GRCm39) I558F probably damaging Het
Adsl T G 15: 80,846,989 (GRCm39) probably null Het
Aldob T C 4: 49,543,842 (GRCm39) I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 (GRCm39) E46G probably damaging Het
Ankrd33b G A 15: 31,367,483 (GRCm39) P19L probably damaging Het
Apoa5 T C 9: 46,181,296 (GRCm39) L124S probably damaging Het
Atp1a4 A T 1: 172,067,664 (GRCm39) L533Q probably benign Het
Atp7b T C 8: 22,550,011 (GRCm39) T9A probably benign Het
Auh G A 13: 53,083,421 (GRCm39) probably benign Het
B3gnt3 T C 8: 72,145,567 (GRCm39) Y267C probably damaging Het
Card11 T C 5: 140,894,279 (GRCm39) T117A possibly damaging Het
Ccdc39 A G 3: 33,898,301 (GRCm39) F15L possibly damaging Het
Chtf18 C T 17: 25,942,434 (GRCm39) R468Q probably benign Het
Cntnap5c T G 17: 58,666,295 (GRCm39) D1108E probably benign Het
Col14a1 G A 15: 55,272,359 (GRCm39) probably benign Het
Col6a6 C T 9: 105,626,047 (GRCm39) probably benign Het
Col9a3 G A 2: 180,251,280 (GRCm39) A317T possibly damaging Het
Cpt1c A T 7: 44,609,256 (GRCm39) probably benign Het
Cpt2 A G 4: 107,761,559 (GRCm39) probably null Het
Crebrf T A 17: 26,982,308 (GRCm39) L565M probably damaging Het
Cyp2d41-ps T A 15: 82,666,236 (GRCm39) noncoding transcript Het
Dhx9 C T 1: 153,348,453 (GRCm39) V291M probably benign Het
Dmxl1 T A 18: 50,011,149 (GRCm39) V1102E probably benign Het
Dnah7a A T 1: 53,496,033 (GRCm39) probably null Het
Dock4 G A 12: 40,787,359 (GRCm39) probably benign Het
Dpp3 G T 19: 4,964,671 (GRCm39) N545K probably damaging Het
Elmo2 T A 2: 165,140,646 (GRCm39) N275I probably damaging Het
Farp1 A G 14: 121,492,925 (GRCm39) K509R probably benign Het
Fat3 T C 9: 15,877,275 (GRCm39) Y3446C possibly damaging Het
Fgd2 T A 17: 29,593,964 (GRCm39) probably benign Het
Flg T A 3: 93,185,028 (GRCm39) probably benign Het
Gas2l2 A T 11: 83,312,736 (GRCm39) W859R probably damaging Het
Gatm T C 2: 122,431,225 (GRCm39) D254G probably damaging Het
Gjd4 T A 18: 9,280,998 (GRCm39) I27F probably damaging Het
Gsdmc2 C A 15: 63,699,604 (GRCm39) probably benign Het
Haus5 C T 7: 30,353,605 (GRCm39) V591I probably benign Het
Kcnab3 G A 11: 69,221,053 (GRCm39) probably null Het
Khdrbs2 A G 1: 32,658,283 (GRCm39) D281G possibly damaging Het
Krt86 A T 15: 101,375,283 (GRCm39) M393L probably benign Het
Limk1 T C 5: 134,701,615 (GRCm39) Y96C probably damaging Het
Lrp2bp T A 8: 46,466,192 (GRCm39) Y100* probably null Het
Mamstr T G 7: 45,291,194 (GRCm39) probably benign Het
Man1a A G 10: 53,795,283 (GRCm39) Y657H probably damaging Het
Marf1 G A 16: 13,929,591 (GRCm39) P1672S possibly damaging Het
Mboat7 T C 7: 3,686,817 (GRCm39) Y341C probably damaging Het
Nhsl1 A T 10: 18,401,417 (GRCm39) N881I probably damaging Het
Nox3 T C 17: 3,733,236 (GRCm39) Y225C probably benign Het
Nrp1 C T 8: 129,227,089 (GRCm39) probably benign Het
Or11g26 T A 14: 50,753,596 (GRCm39) *312K probably null Het
Or4c109 C T 2: 88,817,693 (GRCm39) M284I probably benign Het
Or4c35 C T 2: 89,808,851 (GRCm39) T243I probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or8k33 A G 2: 86,383,976 (GRCm39) F164S probably damaging Het
Pcdhb13 A T 18: 37,577,310 (GRCm39) M563L probably benign Het
Pclo C T 5: 14,590,493 (GRCm39) T931M unknown Het
Peli2 C T 14: 48,358,659 (GRCm39) P16S possibly damaging Het
Pfas G T 11: 68,881,293 (GRCm39) R1025S probably benign Het
Pik3c2a A T 7: 115,953,307 (GRCm39) I1196N probably damaging Het
Pmfbp1 A T 8: 110,262,617 (GRCm39) probably benign Het
Prg4 T C 1: 150,331,837 (GRCm39) T279A possibly damaging Het
Psma1 A T 7: 113,866,440 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,643,149 (GRCm39) L550P probably damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Rmnd5a T C 6: 71,376,215 (GRCm39) H195R probably damaging Het
Rnf17 T C 14: 56,708,830 (GRCm39) L750P probably damaging Het
Rtcb T C 10: 85,793,520 (GRCm39) N18D probably benign Het
Seh1l T C 18: 67,925,086 (GRCm39) probably null Het
Sis T G 3: 72,839,427 (GRCm39) N813T probably benign Het
Sptbn2 T C 19: 4,795,405 (GRCm39) probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Taok3 C T 5: 117,410,294 (GRCm39) Q829* probably null Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tsbp1 T C 17: 34,679,095 (GRCm39) probably null Het
Ttn A G 2: 76,781,886 (GRCm39) probably benign Het
Unc79 A G 12: 103,091,940 (GRCm39) E1756G probably damaging Het
Usp35 A T 7: 96,962,804 (GRCm39) probably null Het
Vmn2r111 A G 17: 22,766,990 (GRCm39) F836L probably benign Het
Vmn2r77 A G 7: 86,451,146 (GRCm39) D344G possibly damaging Het
Zbtb40 A G 4: 136,714,589 (GRCm39) C1067R probably damaging Het
Other mutations in Stag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Stag3 APN 5 138,297,400 (GRCm39) missense probably damaging 1.00
IGL00336:Stag3 APN 5 138,295,921 (GRCm39) missense probably benign 0.42
IGL00514:Stag3 APN 5 138,298,397 (GRCm39) missense probably damaging 1.00
IGL00961:Stag3 APN 5 138,296,611 (GRCm39) missense probably benign 0.01
IGL01923:Stag3 APN 5 138,287,492 (GRCm39) missense probably damaging 1.00
IGL02252:Stag3 APN 5 138,300,810 (GRCm39) missense probably damaging 1.00
IGL02424:Stag3 APN 5 138,289,628 (GRCm39) missense probably damaging 1.00
IGL02424:Stag3 APN 5 138,280,247 (GRCm39) nonsense probably null
IGL02869:Stag3 APN 5 138,280,955 (GRCm39) missense probably damaging 0.96
thor UTSW 5 138,299,298 (GRCm39) critical splice donor site probably null
R0016:Stag3 UTSW 5 138,289,643 (GRCm39) missense possibly damaging 0.50
R0038:Stag3 UTSW 5 138,299,298 (GRCm39) critical splice donor site probably null
R0038:Stag3 UTSW 5 138,299,298 (GRCm39) critical splice donor site probably null
R0046:Stag3 UTSW 5 138,281,285 (GRCm39) splice site probably benign
R1455:Stag3 UTSW 5 138,309,997 (GRCm39) missense probably benign 0.00
R1512:Stag3 UTSW 5 138,296,247 (GRCm39) missense probably benign 0.32
R1530:Stag3 UTSW 5 138,295,674 (GRCm39) missense probably damaging 0.99
R1608:Stag3 UTSW 5 138,296,901 (GRCm39) splice site probably null
R1736:Stag3 UTSW 5 138,302,771 (GRCm39) splice site probably benign
R1969:Stag3 UTSW 5 138,298,400 (GRCm39) missense probably damaging 0.99
R2034:Stag3 UTSW 5 138,296,263 (GRCm39) missense possibly damaging 0.82
R2214:Stag3 UTSW 5 138,299,528 (GRCm39) missense possibly damaging 0.92
R2281:Stag3 UTSW 5 138,296,546 (GRCm39) missense probably damaging 1.00
R2411:Stag3 UTSW 5 138,281,290 (GRCm39) splice site probably benign
R3792:Stag3 UTSW 5 138,296,611 (GRCm39) missense probably benign 0.01
R3887:Stag3 UTSW 5 138,297,101 (GRCm39) missense probably damaging 0.99
R4255:Stag3 UTSW 5 138,289,143 (GRCm39) missense probably damaging 0.98
R4777:Stag3 UTSW 5 138,307,461 (GRCm39) unclassified probably benign
R4842:Stag3 UTSW 5 138,307,627 (GRCm39) splice site probably null
R4854:Stag3 UTSW 5 138,294,956 (GRCm39) splice site probably null
R5045:Stag3 UTSW 5 138,302,740 (GRCm39) missense probably damaging 1.00
R5631:Stag3 UTSW 5 138,294,139 (GRCm39) missense probably damaging 0.96
R5729:Stag3 UTSW 5 138,288,485 (GRCm39) missense possibly damaging 0.76
R5894:Stag3 UTSW 5 138,297,100 (GRCm39) missense probably damaging 0.99
R6004:Stag3 UTSW 5 138,287,468 (GRCm39) missense probably damaging 1.00
R6172:Stag3 UTSW 5 138,298,105 (GRCm39) missense probably benign 0.41
R6503:Stag3 UTSW 5 138,302,682 (GRCm39) missense probably damaging 0.96
R6545:Stag3 UTSW 5 138,296,614 (GRCm39) missense possibly damaging 0.84
R6736:Stag3 UTSW 5 138,299,761 (GRCm39) missense probably damaging 0.98
R6861:Stag3 UTSW 5 138,302,969 (GRCm39) missense possibly damaging 0.55
R7012:Stag3 UTSW 5 138,295,871 (GRCm39) splice site probably null
R7358:Stag3 UTSW 5 138,299,770 (GRCm39) missense probably damaging 1.00
R7378:Stag3 UTSW 5 138,280,222 (GRCm39) missense probably benign 0.00
R7392:Stag3 UTSW 5 138,289,628 (GRCm39) missense probably damaging 1.00
R7395:Stag3 UTSW 5 138,280,207 (GRCm39) missense probably benign 0.33
R7818:Stag3 UTSW 5 138,299,705 (GRCm39) missense probably benign 0.00
R8017:Stag3 UTSW 5 138,299,465 (GRCm39) missense possibly damaging 0.80
R8019:Stag3 UTSW 5 138,299,465 (GRCm39) missense possibly damaging 0.80
R8076:Stag3 UTSW 5 138,281,404 (GRCm39) missense probably damaging 0.96
R8393:Stag3 UTSW 5 138,295,017 (GRCm39) missense probably damaging 0.98
R8405:Stag3 UTSW 5 138,302,914 (GRCm39) missense probably damaging 0.99
R8417:Stag3 UTSW 5 138,306,850 (GRCm39) missense probably benign
R8734:Stag3 UTSW 5 138,310,050 (GRCm39) missense probably benign 0.36
R8848:Stag3 UTSW 5 138,288,528 (GRCm39) missense probably null 0.97
R8966:Stag3 UTSW 5 138,289,666 (GRCm39) missense probably damaging 0.99
R9029:Stag3 UTSW 5 138,296,296 (GRCm39) missense probably damaging 1.00
R9292:Stag3 UTSW 5 138,299,712 (GRCm39) missense probably benign 0.01
R9410:Stag3 UTSW 5 138,297,601 (GRCm39) missense possibly damaging 0.95
R9645:Stag3 UTSW 5 138,299,701 (GRCm39) missense possibly damaging 0.78
R9723:Stag3 UTSW 5 138,298,103 (GRCm39) missense probably benign
Z1177:Stag3 UTSW 5 138,299,554 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAACCTGGAAGGGACTCAGGTGAT -3'
(R):5'- ACCAACCTGTGTGGTATTTATGCCAA -3'

Sequencing Primer
(F):5'- GGGACTCAGGTGATGGAATG -3'
(R):5'- TCCAGGTAGTAAGACTTATACATGG -3'
Posted On 2013-05-29