Incidental Mutation 'R5568:Sorcs2'
ID437004
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Namesortilin-related VPS10 domain containing receptor 2
SynonymsVPS10 domain receptor protein
MMRRC Submission 043125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5568 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36017180-36398139 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 36046530 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 540 (Y540*)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
Predicted Effect probably null
Transcript: ENSMUST00000037370
AA Change: Y540*
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: Y540*

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Clp1 T A 2: 84,725,978 K53* probably null Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx24 T A 12: 103,424,288 Q59L possibly damaging Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Ddx58 T A 4: 40,222,140 M380L probably benign Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
Glis1 T C 4: 107,619,635 S518P probably damaging Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Nfatc1 A T 18: 80,649,822 V688D probably benign Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Ptk6 A T 2: 181,199,695 N140K possibly damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Stradb T A 1: 58,992,742 M271K possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36037401 splice site probably null
IGL01064:Sorcs2 APN 5 36065352 missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36021252 missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36047809 missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36025942 missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36062552 missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36077957 missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36068148 missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36065331 unclassified probably benign
IGL03141:Sorcs2 APN 5 36065355 missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36031212 missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36046504 missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36153845 missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36397553 splice site probably benign
R0345:Sorcs2 UTSW 5 36027874 missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36031190 missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36065433 missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36024572 missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36027925 missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36026748 missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36229220 splice site probably benign
R1935:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36042086 splice site probably null
R3148:Sorcs2 UTSW 5 36035788 missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36397806 missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36397663 nonsense probably null
R4092:Sorcs2 UTSW 5 36025822 missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36037494 missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36043452 missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36039390 missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36031183 missense probably benign 0.00
R5727:Sorcs2 UTSW 5 36031286 missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36229211 missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36229191 missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36029083 missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36019384 missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36027988 splice site probably null
R6290:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36077966 missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36397810 missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36021261 missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36068130 missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36025876 missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36027978 missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36043527 missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36024072 missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36024614 missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36062614 missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36062588 missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36038206 missense probably benign 0.00
RF063:Sorcs2 UTSW 5 36153811 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGATGGCCAGGTGTAGACAC -3'
(R):5'- TCTTTCTGCCCAGAGAGAACC -3'

Sequencing Primer
(F):5'- GTGTAGACACCTGGCTCAG -3'
(R):5'- CATACCAGGCCACTGTCTG -3'
Posted On2016-10-24