Mutagenetix > Incidental Mutation

Incidental Mutation 'R0046:Card11'

43701

Institutional Source

Beutler Lab

Gene Symbol

Card11

Ensembl Gene

ENSMUSG00000036526

Gene Name

caspase recruitment domain family, member 11

Synonyms

CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik

MMRRC Submission

038340-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140872990-141000582 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140908524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 117 (T117A)

Ref Sequence

ENSEMBL: ENSMUSP00000082941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085786]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085786
AA Change: T117A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: T117A

Domain	Start	End	E-Value	Type
Pfam:CARD	23	109	1.3e-23	PFAM
coiled coil region	176	440	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
low complexity region	535	549	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
PDZ	674	755	2.73e-1	SMART
Blast:SH3	776	838	1e-10	BLAST
low complexity region	839	850	N/A	INTRINSIC
low complexity region	920	934	N/A	INTRINSIC
SCOP:d1kjwa2	970	1149	1e-18	SMART
Blast:GuKc	973	1139	1e-102	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199091

Meta Mutation Damage Score

0.0781

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	T	4: 56,743,877	K135*	probably null	Het
Adamts16	A	G	13: 70,763,460	S871P	probably benign	Het
Adcy10	A	T	1: 165,539,834	I558F	probably damaging	Het
Adsl	T	G	15: 80,962,788		probably null	Het
Aldob	T	C	4: 49,543,842	I47V	possibly damaging	Het
Alkbh8	A	G	9: 3,343,247	E46G	probably damaging	Het
Ankrd33b	G	A	15: 31,367,337	P19L	probably damaging	Het
Apoa5	T	C	9: 46,269,998	L124S	probably damaging	Het
Atp1a4	A	T	1: 172,240,097	L533Q	probably benign	Het
Atp7b	T	C	8: 22,059,995	T9A	probably benign	Het
Auh	G	A	13: 52,929,385		probably benign	Het
B3gnt3	T	C	8: 71,692,923	Y267C	probably damaging	Het
BC051142	T	C	17: 34,460,121		probably null	Het
Ccdc39	A	G	3: 33,844,152	F15L	possibly damaging	Het
Chtf18	C	T	17: 25,723,460	R468Q	probably benign	Het
Cntnap5c	T	G	17: 58,359,300	D1108E	probably benign	Het
Col14a1	G	A	15: 55,408,963		probably benign	Het
Col6a6	C	T	9: 105,748,848		probably benign	Het
Col9a3	G	A	2: 180,609,487	A317T	possibly damaging	Het
Cpt1c	A	T	7: 44,959,832		probably benign	Het
Cpt2	A	G	4: 107,904,362		probably null	Het
Crebrf	T	A	17: 26,763,334	L565M	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,782,035		noncoding transcript	Het
Dhx9	C	T	1: 153,472,707	V291M	probably benign	Het
Dmxl1	T	A	18: 49,878,082	V1102E	probably benign	Het
Dnah7a	A	T	1: 53,456,874		probably null	Het
Dock4	G	A	12: 40,737,360		probably benign	Het
Dpp3	G	T	19: 4,914,643	N545K	probably damaging	Het
Elmo2	T	A	2: 165,298,726	N275I	probably damaging	Het
Farp1	A	G	14: 121,255,513	K509R	probably benign	Het
Fat3	T	C	9: 15,965,979	Y3446C	possibly damaging	Het
Fgd2	T	A	17: 29,374,990		probably benign	Het
Flg	T	A	3: 93,277,721		probably benign	Het
Gas2l2	A	T	11: 83,421,910	W859R	probably damaging	Het
Gatm	T	C	2: 122,600,744	D254G	probably damaging	Het
Gjd4	T	A	18: 9,280,998	I27F	probably damaging	Het
Gsdmc2	C	A	15: 63,827,755		probably benign	Het
Haus5	C	T	7: 30,654,180	V591I	probably benign	Het
Kcnab3	G	A	11: 69,330,227		probably null	Het
Khdrbs2	A	G	1: 32,619,202	D281G	possibly damaging	Het
Krt86	A	T	15: 101,477,402	M393L	probably benign	Het
Limk1	T	C	5: 134,672,761	Y96C	probably damaging	Het
Lrp2bp	T	A	8: 46,013,155	Y100*	probably null	Het
Mamstr	T	G	7: 45,641,770		probably benign	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Marf1	G	A	16: 14,111,727	P1672S	possibly damaging	Het
Mboat7	T	C	7: 3,683,818	Y341C	probably damaging	Het
Nhsl1	A	T	10: 18,525,669	N881I	probably damaging	Het
Nox3	T	C	17: 3,682,961	Y225C	probably benign	Het
Nrp1	C	T	8: 128,500,608		probably benign	Het
Olfr1080	A	G	2: 86,553,632	F164S	probably damaging	Het
Olfr1214	C	T	2: 88,987,349	M284I	probably benign	Het
Olfr1260	C	T	2: 89,978,507	T243I	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr742	T	A	14: 50,516,139	*312K	probably null	Het
Pcdhb13	A	T	18: 37,444,257	M563L	probably benign	Het
Pclo	C	T	5: 14,540,479	T931M	unknown	Het
Peli2	C	T	14: 48,121,202	P16S	possibly damaging	Het
Pfas	G	T	11: 68,990,467	R1025S	probably benign	Het
Pik3c2a	A	T	7: 116,354,072	I1196N	probably damaging	Het
Pmfbp1	A	T	8: 109,535,985		probably benign	Het
Prg4	T	C	1: 150,456,086	T279A	possibly damaging	Het
Psma1	A	T	7: 114,267,205		probably benign	Het
Rab11fip1	A	G	8: 27,153,121	L550P	probably damaging	Het
Rgs12	T	A	5: 34,965,320	I149N	probably damaging	Het
Rmnd5a	T	C	6: 71,399,231	H195R	probably damaging	Het
Rnf17	T	C	14: 56,471,373	L750P	probably damaging	Het
Rtcb	T	C	10: 85,957,656	N18D	probably benign	Het
Seh1l	T	C	18: 67,792,016		probably null	Het
Sis	T	G	3: 72,932,094	N813T	probably benign	Het
Sptbn2	T	C	19: 4,745,377		probably benign	Het
Stag3	C	T	5: 138,283,023		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Taok3	C	T	5: 117,272,229	Q829*	probably null	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttn	A	G	2: 76,951,542		probably benign	Het
Unc79	A	G	12: 103,125,681	E1756G	probably damaging	Het
Usp35	A	T	7: 97,313,597		probably null	Het
Vmn2r111	A	G	17: 22,548,009	F836L	probably benign	Het
Vmn2r77	A	G	7: 86,801,938	D344G	possibly damaging	Het
Zbtb40	A	G	4: 136,987,278	C1067R	probably damaging	Het

Other mutations in Card11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
unmodulated	APN	5	140897997	intron	probably benign
IGL00961:Card11	APN	5	140899709	missense	probably damaging	0.97
IGL01645:Card11	APN	5	140878023	missense	probably benign	0.00
IGL01731:Card11	APN	5	140882302	missense	possibly damaging	0.89
IGL01782:Card11	APN	5	140927726	start codon destroyed	probably null	0.02
IGL01935:Card11	APN	5	140883546	missense	possibly damaging	0.62
IGL01991:Card11	APN	5	140913378	missense	possibly damaging	0.63
IGL02447:Card11	APN	5	140906924	missense	possibly damaging	0.93
IGL02583:Card11	APN	5	140878126	missense	probably benign	0.10
IGL03255:Card11	APN	5	140898331	missense	possibly damaging	0.73
Ace	UTSW	5	140902877	missense	possibly damaging	0.70
Caravaggio	UTSW	5	140913309	missense	probably damaging	1.00
Dealer	UTSW	5	140885877	missense	probably damaging	1.00
Dogs	UTSW	5	140882000	critical splice donor site	probably null
Face	UTSW	5	140900977	missense	probably damaging	1.00
hubei	UTSW	5	140906767	missense	probably damaging	0.96
king	UTSW	5	140891080	splice site	probably benign
may	UTSW	5	140876495	nonsense	probably null
Poker	UTSW	5	140878082	missense	probably benign
Sharp	UTSW	5	140876425	missense	possibly damaging	0.93
Tumnus	UTSW	5	140885945	missense	possibly damaging	0.75
unmodulated2	UTSW	5	140883782	splice site	probably null
PIT4243001:Card11	UTSW	5	140908604	missense	possibly damaging	0.95
PIT4486001:Card11	UTSW	5	140876408	missense	probably damaging	1.00
PIT4531001:Card11	UTSW	5	140906660	missense	probably damaging	0.99
R0285:Card11	UTSW	5	140887101	missense	probably damaging	1.00
R0452:Card11	UTSW	5	140880370	missense	probably benign	0.01
R1486:Card11	UTSW	5	140876519	missense	probably benign
R1710:Card11	UTSW	5	140902905	nonsense	probably null
R1733:Card11	UTSW	5	140906633	missense	possibly damaging	0.88
R1817:Card11	UTSW	5	140885560	missense	probably benign	0.00
R1818:Card11	UTSW	5	140885560	missense	probably benign	0.00
R2027:Card11	UTSW	5	140906767	missense	probably damaging	0.96
R2436:Card11	UTSW	5	140882362	missense	possibly damaging	0.89
R2904:Card11	UTSW	5	140889133	missense	probably benign	0.09
R3706:Card11	UTSW	5	140887135	missense	probably damaging	0.99
R3708:Card11	UTSW	5	140887135	missense	probably damaging	0.99
R4778:Card11	UTSW	5	140883782	splice site	probably null
R4877:Card11	UTSW	5	140885877	missense	probably damaging	1.00
R4889:Card11	UTSW	5	140885945	missense	possibly damaging	0.75
R4910:Card11	UTSW	5	140874414	missense	probably damaging	1.00
R5011:Card11	UTSW	5	140876520	missense	possibly damaging	0.93
R5257:Card11	UTSW	5	140876425	missense	possibly damaging	0.93
R5258:Card11	UTSW	5	140876425	missense	possibly damaging	0.93
R5682:Card11	UTSW	5	140902911	nonsense	probably null
R5754:Card11	UTSW	5	140899769	missense	probably damaging	0.99
R5873:Card11	UTSW	5	140908638	missense	probably damaging	1.00
R6184:Card11	UTSW	5	140898278	missense	probably damaging	1.00
R6792:Card11	UTSW	5	140913309	missense	probably damaging	1.00
R6825:Card11	UTSW	5	140878082	missense	probably benign
R7008:Card11	UTSW	5	140873393	missense	probably damaging	1.00
R7291:Card11	UTSW	5	140901070	missense	probably damaging	1.00
R7376:Card11	UTSW	5	140898238	missense	probably benign	0.01
R7526:Card11	UTSW	5	140913429	splice site	probably null
R7683:Card11	UTSW	5	140896026	missense	probably benign
R7730:Card11	UTSW	5	140885996	missense	probably damaging	0.96
R7813:Card11	UTSW	5	140899664	missense	probably damaging	1.00
R7831:Card11	UTSW	5	140873412	missense	possibly damaging	0.61
R7911:Card11	UTSW	5	140882000	critical splice donor site	probably null
R8154:Card11	UTSW	5	140900977	missense	probably damaging	1.00
R8224:Card11	UTSW	5	140902877	missense	possibly damaging	0.70
R8272:Card11	UTSW	5	140890039	missense	probably damaging	1.00
R8714:Card11	UTSW	5	140913392	missense	possibly damaging	0.67
R8715:Card11	UTSW	5	140885560	missense	probably benign	0.00
R9065:Card11	UTSW	5	140908542	missense	probably damaging	1.00
R9211:Card11	UTSW	5	140883620	missense	probably benign	0.16
R9215:Card11	UTSW	5	140880399	missense	possibly damaging	0.64
R9269:Card11	UTSW	5	140906761	missense	probably damaging	0.99
R9385:Card11	UTSW	5	140885521	missense	probably benign	0.44
R9421:Card11	UTSW	5	140883707	missense	probably damaging	0.97
R9424:Card11	UTSW	5	140908640	missense	probably damaging	1.00
R9444:Card11	UTSW	5	140908638	missense	probably damaging	1.00
V7732:Card11	UTSW	5	140876495	nonsense	probably null
X0067:Card11	UTSW	5	140885592	missense	possibly damaging	0.60
Z1177:Card11	UTSW	5	140898241	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- AAACTGGCAAAGTGACCCCTGGAG -3'
(R):5'- AGACACAGGGCCTGTCATCCAATC -3'

Sequencing Primer
(F):5'- gcataaactcacatgcacacac -3'
(R):5'- GGCCTGTCATCCAATCAAACAC -3'

Posted On

2013-05-29