Incidental Mutation 'R0046:Card11'
ID43701
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Namecaspase recruitment domain family, member 11
SynonymsCARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location140872990-141000582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140908524 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 117 (T117A)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085786
AA Change: T117A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: T117A

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199091
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Caravaggio UTSW 5 140913309 missense probably damaging 1.00
Dealer UTSW 5 140885877 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.96
king UTSW 5 140891080 splice site probably benign
may UTSW 5 140876495 nonsense probably null
Poker UTSW 5 140878082 missense probably benign
Sharp UTSW 5 140876425 missense possibly damaging 0.93
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 splice site probably null
PIT4243001:Card11 UTSW 5 140908604 missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140876408 missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140906660 missense probably damaging 0.99
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6792:Card11 UTSW 5 140913309 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
R7008:Card11 UTSW 5 140873393 missense probably damaging 1.00
R7291:Card11 UTSW 5 140901070 missense probably damaging 1.00
R7376:Card11 UTSW 5 140898238 missense probably benign 0.01
R7526:Card11 UTSW 5 140913429 intron probably null
R7683:Card11 UTSW 5 140896026 missense probably benign
R7730:Card11 UTSW 5 140885996 missense probably damaging 0.96
R7813:Card11 UTSW 5 140899664 missense probably damaging 1.00
R7831:Card11 UTSW 5 140873412 missense possibly damaging 0.61
R7911:Card11 UTSW 5 140882000 critical splice donor site probably null
R7914:Card11 UTSW 5 140873412 missense possibly damaging 0.61
R7992:Card11 UTSW 5 140882000 critical splice donor site probably null
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Z1177:Card11 UTSW 5 140898241 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AAACTGGCAAAGTGACCCCTGGAG -3'
(R):5'- AGACACAGGGCCTGTCATCCAATC -3'

Sequencing Primer
(F):5'- gcataaactcacatgcacacac -3'
(R):5'- GGCCTGTCATCCAATCAAACAC -3'
Posted On2013-05-29