Mutagenetix > Incidental Mutations

Incidental Mutation 'R5568:Ticrr'

437022

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

MMRRC Submission

043125-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R5568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 79695296 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1636 (C1636*)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]

Predicted Effect

probably null
Transcript: ENSMUST00000035977
AA Change: C1636*

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: C1636*

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059836

SMART Domains

Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178048

SMART Domains

Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183846

SMART Domains

Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184137

SMART Domains

Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206591

Predicted Effect

probably benign
Transcript: ENSMUST00000206622

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	T	C	4: 144,622,794	V207A	probably benign	Het
Abcc10	C	A	17: 46,303,908		probably null	Het
Abcc9	A	C	6: 142,689,016	V174G	possibly damaging	Het
Abl1	C	T	2: 31,779,074	A155V	probably damaging	Het
Aco2	T	A	15: 81,903,586	D212E	probably damaging	Het
Adam26b	A	T	8: 43,520,492	M491K	probably benign	Het
Anapc5	G	A	5: 122,791,925		probably benign	Het
Atf7	A	G	15: 102,563,322	I46T	probably damaging	Het
Cacna1b	A	G	2: 24,607,600	S2100P	probably damaging	Het
Capn5	T	A	7: 98,125,930	D501V	probably damaging	Het
Cc2d2a	A	G	5: 43,709,091	M748V	probably damaging	Het
Cd300c2	T	C	11: 115,000,836	T71A	probably damaging	Het
Chmp2a	T	C	7: 13,033,831	M56V	probably benign	Het
Cilp	A	C	9: 65,280,233	R1203S	probably benign	Het
Clp1	T	A	2: 84,725,978	K53*	probably null	Het
Crhbp	T	A	13: 95,442,229	D128V	probably damaging	Het
Crispld1	T	A	1: 17,750,271	I292N	probably benign	Het
Cyp2c68	A	T	19: 39,689,082	I488N	probably benign	Het
Cyp3a57	A	T	5: 145,370,646	M149L	probably benign	Het
Ddx24	T	A	12: 103,424,288	Q59L	possibly damaging	Het
Ddx27	A	G	2: 167,029,519	H512R	possibly damaging	Het
Ddx58	T	A	4: 40,222,140	M380L	probably benign	Het
Dlgap4	T	A	2: 156,762,901	*993K	probably null	Het
Dmxl2	A	T	9: 54,423,359		probably null	Het
Dus4l	A	T	12: 31,646,713	F88L	probably damaging	Het
Ep400	A	T	5: 110,756,205	V176E	probably damaging	Het
Fam71e1	T	G	7: 44,501,004	S207A	probably damaging	Het
Fat3	T	A	9: 16,376,923	K435*	probably null	Het
Fsip2	T	C	2: 82,986,564	C4214R	probably benign	Het
Gfral	T	C	9: 76,164,805	*394W	probably null	Het
Glis1	T	C	4: 107,619,635	S518P	probably damaging	Het
H2-T10	A	G	17: 36,119,187		probably null	Het
Hsbp1l1	T	C	18: 80,235,464	T35A	possibly damaging	Het
Ighv5-12	A	G	12: 113,702,217	F87S	probably damaging	Het
Ints13	A	C	6: 146,576,357	D31E	probably damaging	Het
Kbtbd12	C	T	6: 88,618,627	D74N	probably damaging	Het
Klrb1c	A	G	6: 128,788,914		probably benign	Het
Kmt5b	A	T	19: 3,786,538	H25L	probably benign	Het
Krt28	A	T	11: 99,371,384	M260K	probably damaging	Het
Krt79	A	G	15: 101,929,785	S512P	probably damaging	Het
Lama1	A	T	17: 67,768,298		probably null	Het
Maneal	T	C	4: 124,857,144	E273G	possibly damaging	Het
Map4k3	T	A	17: 80,663,998	Y80F	possibly damaging	Het
Mbd6	A	G	10: 127,283,428	V946A	possibly damaging	Het
Mfsd14b	A	T	13: 65,072,122		probably null	Het
Mrpl46	C	G	7: 78,780,494	W176S	probably damaging	Het
Muc19	A	G	15: 91,884,274		noncoding transcript	Het
Mup3	T	G	4: 62,084,572	E184A	possibly damaging	Het
Myo9a	A	G	9: 59,874,628	H1699R	probably benign	Het
Ndrg2	T	A	14: 51,906,963	T269S	probably damaging	Het
Nfatc1	A	T	18: 80,649,822	V688D	probably benign	Het
Ninj2	T	C	6: 120,198,709	I101T	probably benign	Het
Nlrp10	T	A	7: 108,924,261	M671L	probably benign	Het
Npsr1	T	A	9: 24,313,214	L296I	probably damaging	Het
Olfr582	G	T	7: 103,042,310	R272L	possibly damaging	Het
Olfr975	A	G	9: 39,950,687	L28P	probably benign	Het
Pacsin1	T	A	17: 27,708,048	D242E	probably damaging	Het
Pcdh1	T	C	18: 38,197,367	Y861C	probably damaging	Het
Pcdha12	T	C	18: 37,020,390	L54P	probably damaging	Het
Pcdhb18	T	A	18: 37,491,800	S728T	probably benign	Het
Phyhd1	T	A	2: 30,277,010	H108Q	probably damaging	Het
Plcb1	A	T	2: 135,370,593	I1035F	probably damaging	Het
Plcl1	T	C	1: 55,696,150	S217P	possibly damaging	Het
Plppr2	G	A	9: 21,941,129	R103H	probably damaging	Het
Plxnb2	G	A	15: 89,157,435	T1722I	probably damaging	Het
Pole3	T	C	4: 62,524,431	N53S	probably damaging	Het
Ptk6	A	T	2: 181,199,695	N140K	possibly damaging	Het
Rab12	C	T	17: 66,497,423	R180H	probably damaging	Het
Rab36	G	T	10: 75,052,479	V252L	probably benign	Het
Ranbp3	T	C	17: 56,701,543		probably null	Het
Rapgef2	A	G	3: 79,104,001	L259P	probably damaging	Het
Scaf4	GGCTGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTGCTG	16: 90,229,857		probably benign	Het
Scd2	T	C	19: 44,299,703	F178S	probably damaging	Het
Shmt2	A	G	10: 127,520,381	S87P	probably damaging	Het
Slf1	T	A	13: 77,046,704	D834V	probably damaging	Het
Sorcs2	A	C	5: 36,046,530	Y540*	probably null	Het
Srpk2	T	A	5: 23,525,699	Q274L	possibly damaging	Het
Stradb	T	A	1: 58,992,742	M271K	possibly damaging	Het
Tfec	T	A	6: 16,867,593	Q16L	possibly damaging	Het
Tfg	T	C	16: 56,701,087	T63A	probably benign	Het
Tln2	A	G	9: 67,311,865	I266T	probably damaging	Het
Tmcc1	G	C	6: 116,022,110	R323G	possibly damaging	Het
Tnnt3	A	G	7: 142,512,040	E138G	probably damaging	Het
Tpm2	C	A	4: 43,522,692	E75*	probably null	Het
Ttn	T	G	2: 76,750,578	T23324P	probably damaging	Het
Ubr4	T	G	4: 139,392,038	L176R	probably damaging	Het
Uhrf2	G	T	19: 30,039,088	D46Y	probably damaging	Het
Ulbp1	A	C	10: 7,473,281	S21A	unknown	Het
Usp17lb	C	T	7: 104,841,208	G170R	probably damaging	Het
Utp15	T	C	13: 98,257,925	N153S	probably benign	Het
Vcan	T	A	13: 89,688,671	E2918V	probably damaging	Het
Vmn1r174	T	A	7: 23,754,494	I195K	probably damaging	Het
Vmn1r76	C	T	7: 11,931,135	V16I	probably benign	Het
Xdh	T	C	17: 73,943,885	D24G	possibly damaging	Het
Xylb	T	A	9: 119,361,132	H68Q	probably benign	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	unclassified	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TTCTTTTGGAAGCTGAGGCCC -3'
(R):5'- TCAAGCAGTGACAAGGACC -3'

Sequencing Primer
(F):5'- GCTGAGGCCCTAGGAAAGG -3'
(R):5'- ACCCAGGAAGGTCCATACTGG -3'

Posted On

2016-10-24