Incidental Mutation 'R5568:Ticrr'
ID 437022
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 043125-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R5568 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 79345044 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1636 (C1636*)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably null
Transcript: ENSMUST00000035977
AA Change: C1636*
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: C1636*

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,349,364 (GRCm39) V207A probably benign Het
Abcc10 C A 17: 46,614,834 (GRCm39) probably null Het
Abcc9 A C 6: 142,634,742 (GRCm39) V174G possibly damaging Het
Abl1 C T 2: 31,669,086 (GRCm39) A155V probably damaging Het
Aco2 T A 15: 81,787,787 (GRCm39) D212E probably damaging Het
Adam26b A T 8: 43,973,529 (GRCm39) M491K probably benign Het
Anapc5 G A 5: 122,929,988 (GRCm39) probably benign Het
Atf7 A G 15: 102,471,757 (GRCm39) I46T probably damaging Het
Cacna1b A G 2: 24,497,612 (GRCm39) S2100P probably damaging Het
Capn5 T A 7: 97,775,137 (GRCm39) D501V probably damaging Het
Cc2d2a A G 5: 43,866,433 (GRCm39) M748V probably damaging Het
Cd300c2 T C 11: 114,891,662 (GRCm39) T71A probably damaging Het
Chmp2a T C 7: 12,767,758 (GRCm39) M56V probably benign Het
Cilp A C 9: 65,187,515 (GRCm39) R1203S probably benign Het
Clp1 T A 2: 84,556,322 (GRCm39) K53* probably null Het
Crhbp T A 13: 95,578,737 (GRCm39) D128V probably damaging Het
Crispld1 T A 1: 17,820,495 (GRCm39) I292N probably benign Het
Cyp2c68 A T 19: 39,677,526 (GRCm39) I488N probably benign Het
Cyp3a57 A T 5: 145,307,456 (GRCm39) M149L probably benign Het
Ddx24 T A 12: 103,390,547 (GRCm39) Q59L possibly damaging Het
Ddx27 A G 2: 166,871,439 (GRCm39) H512R possibly damaging Het
Dlgap4 T A 2: 156,604,821 (GRCm39) *993K probably null Het
Dmxl2 A T 9: 54,330,643 (GRCm39) probably null Het
Dus4l A T 12: 31,696,712 (GRCm39) F88L probably damaging Het
Ep400 A T 5: 110,904,071 (GRCm39) V176E probably damaging Het
Fat3 T A 9: 16,288,219 (GRCm39) K435* probably null Het
Fsip2 T C 2: 82,816,908 (GRCm39) C4214R probably benign Het
Garin5a T G 7: 44,150,428 (GRCm39) S207A probably damaging Het
Gfral T C 9: 76,072,087 (GRCm39) *394W probably null Het
Glis1 T C 4: 107,476,832 (GRCm39) S518P probably damaging Het
H2-T10 A G 17: 36,430,079 (GRCm39) probably null Het
Hsbp1l1 T C 18: 80,278,679 (GRCm39) T35A possibly damaging Het
Ighv5-12 A G 12: 113,665,837 (GRCm39) F87S probably damaging Het
Ints13 A C 6: 146,477,855 (GRCm39) D31E probably damaging Het
Kbtbd12 C T 6: 88,595,609 (GRCm39) D74N probably damaging Het
Klrb1c A G 6: 128,765,877 (GRCm39) probably benign Het
Kmt5b A T 19: 3,836,538 (GRCm39) H25L probably benign Het
Krt28 A T 11: 99,262,210 (GRCm39) M260K probably damaging Het
Krt79 A G 15: 101,838,220 (GRCm39) S512P probably damaging Het
Lama1 A T 17: 68,075,293 (GRCm39) probably null Het
Maneal T C 4: 124,750,937 (GRCm39) E273G possibly damaging Het
Map4k3 T A 17: 80,971,427 (GRCm39) Y80F possibly damaging Het
Mbd6 A G 10: 127,119,297 (GRCm39) V946A possibly damaging Het
Mfsd14b A T 13: 65,219,936 (GRCm39) probably null Het
Mrpl46 C G 7: 78,430,242 (GRCm39) W176S probably damaging Het
Muc19 A G 15: 91,768,468 (GRCm39) noncoding transcript Het
Mup3 T G 4: 62,002,809 (GRCm39) E184A possibly damaging Het
Myo9a A G 9: 59,781,911 (GRCm39) H1699R probably benign Het
Ndrg2 T A 14: 52,144,420 (GRCm39) T269S probably damaging Het
Nfatc1 A T 18: 80,693,037 (GRCm39) V688D probably benign Het
Ninj2 T C 6: 120,175,670 (GRCm39) I101T probably benign Het
Nlrp10 T A 7: 108,523,468 (GRCm39) M671L probably benign Het
Npsr1 T A 9: 24,224,510 (GRCm39) L296I probably damaging Het
Or10d5 A G 9: 39,861,983 (GRCm39) L28P probably benign Het
Or52r1b G T 7: 102,691,517 (GRCm39) R272L possibly damaging Het
Pacsin1 T A 17: 27,927,022 (GRCm39) D242E probably damaging Het
Pcdh1 T C 18: 38,330,420 (GRCm39) Y861C probably damaging Het
Pcdha12 T C 18: 37,153,443 (GRCm39) L54P probably damaging Het
Pcdhb18 T A 18: 37,624,853 (GRCm39) S728T probably benign Het
Phyhd1 T A 2: 30,167,022 (GRCm39) H108Q probably damaging Het
Plcb1 A T 2: 135,212,513 (GRCm39) I1035F probably damaging Het
Plcl1 T C 1: 55,735,309 (GRCm39) S217P possibly damaging Het
Plppr2 G A 9: 21,852,425 (GRCm39) R103H probably damaging Het
Plxnb2 G A 15: 89,041,638 (GRCm39) T1722I probably damaging Het
Pole3 T C 4: 62,442,668 (GRCm39) N53S probably damaging Het
Ptk6 A T 2: 180,841,488 (GRCm39) N140K possibly damaging Het
Rab12 C T 17: 66,804,418 (GRCm39) R180H probably damaging Het
Rab36 G T 10: 74,888,311 (GRCm39) V252L probably benign Het
Ranbp3 T C 17: 57,008,543 (GRCm39) probably null Het
Rapgef2 A G 3: 79,011,308 (GRCm39) L259P probably damaging Het
Rigi T A 4: 40,222,140 (GRCm39) M380L probably benign Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,026,745 (GRCm39) probably benign Het
Scd2 T C 19: 44,288,142 (GRCm39) F178S probably damaging Het
Shmt2 A G 10: 127,356,250 (GRCm39) S87P probably damaging Het
Slf1 T A 13: 77,194,823 (GRCm39) D834V probably damaging Het
Sorcs2 A C 5: 36,203,874 (GRCm39) Y540* probably null Het
Srpk2 T A 5: 23,730,697 (GRCm39) Q274L possibly damaging Het
Stradb T A 1: 59,031,901 (GRCm39) M271K possibly damaging Het
Tfec T A 6: 16,867,592 (GRCm39) Q16L possibly damaging Het
Tfg T C 16: 56,521,450 (GRCm39) T63A probably benign Het
Tln2 A G 9: 67,219,147 (GRCm39) I266T probably damaging Het
Tmcc1 G C 6: 115,999,071 (GRCm39) R323G possibly damaging Het
Tnnt3 A G 7: 142,065,777 (GRCm39) E138G probably damaging Het
Tpm2 C A 4: 43,522,692 (GRCm39) E75* probably null Het
Ttn T G 2: 76,580,922 (GRCm39) T23324P probably damaging Het
Ubr4 T G 4: 139,119,349 (GRCm39) L176R probably damaging Het
Uhrf2 G T 19: 30,016,488 (GRCm39) D46Y probably damaging Het
Ulbp1 A C 10: 7,423,281 (GRCm39) S21A unknown Het
Usp17lb C T 7: 104,490,415 (GRCm39) G170R probably damaging Het
Utp15 T C 13: 98,394,433 (GRCm39) N153S probably benign Het
Vcan T A 13: 89,836,790 (GRCm39) E2918V probably damaging Het
Vmn1r174 T A 7: 23,453,919 (GRCm39) I195K probably damaging Het
Vmn1r76 C T 7: 11,665,062 (GRCm39) V16I probably benign Het
Xdh T C 17: 74,250,880 (GRCm39) D24G possibly damaging Het
Xylb T A 9: 119,190,198 (GRCm39) H68Q probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTCTTTTGGAAGCTGAGGCCC -3'
(R):5'- TCAAGCAGTGACAAGGACC -3'

Sequencing Primer
(F):5'- GCTGAGGCCCTAGGAAAGG -3'
(R):5'- ACCCAGGAAGGTCCATACTGG -3'
Posted On 2016-10-24