Mutagenetix > Incidental Mutation

Incidental Mutation 'R5568:Cilp'

437036

Institutional Source

Beutler Lab

Gene Symbol

Cilp

Ensembl Gene

ENSMUSG00000042254

Gene Name

cartilage intermediate layer protein, nucleotide pyrophosphohydrolase

Synonyms

C130036G17Rik

MMRRC Submission

043125-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65265180-65280605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 65280233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1203 (R1203S)

Ref Sequence

ENSEMBL: ENSMUSP00000036631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048762
AA Change: R1203S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254
AA Change: R1203S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Mucin2_WxxW	55	139	1.9e-24	PFAM
TSP1	152	201	3.09e-10	SMART
low complexity region	233	242	N/A	INTRINSIC
IGc2	321	383	4.45e-10	SMART
low complexity region	1154	1170	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141382

SMART Domains

Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	T	C	4: 144,622,794	V207A	probably benign	Het
Abcc10	C	A	17: 46,303,908		probably null	Het
Abcc9	A	C	6: 142,689,016	V174G	possibly damaging	Het
Abl1	C	T	2: 31,779,074	A155V	probably damaging	Het
Aco2	T	A	15: 81,903,586	D212E	probably damaging	Het
Adam26b	A	T	8: 43,520,492	M491K	probably benign	Het
Anapc5	G	A	5: 122,791,925		probably benign	Het
Atf7	A	G	15: 102,563,322	I46T	probably damaging	Het
Cacna1b	A	G	2: 24,607,600	S2100P	probably damaging	Het
Capn5	T	A	7: 98,125,930	D501V	probably damaging	Het
Cc2d2a	A	G	5: 43,709,091	M748V	probably damaging	Het
Cd300c2	T	C	11: 115,000,836	T71A	probably damaging	Het
Chmp2a	T	C	7: 13,033,831	M56V	probably benign	Het
Clp1	T	A	2: 84,725,978	K53*	probably null	Het
Crhbp	T	A	13: 95,442,229	D128V	probably damaging	Het
Crispld1	T	A	1: 17,750,271	I292N	probably benign	Het
Cyp2c68	A	T	19: 39,689,082	I488N	probably benign	Het
Cyp3a57	A	T	5: 145,370,646	M149L	probably benign	Het
Ddx24	T	A	12: 103,424,288	Q59L	possibly damaging	Het
Ddx27	A	G	2: 167,029,519	H512R	possibly damaging	Het
Ddx58	T	A	4: 40,222,140	M380L	probably benign	Het
Dlgap4	T	A	2: 156,762,901	*993K	probably null	Het
Dmxl2	A	T	9: 54,423,359		probably null	Het
Dus4l	A	T	12: 31,646,713	F88L	probably damaging	Het
Ep400	A	T	5: 110,756,205	V176E	probably damaging	Het
Fam71e1	T	G	7: 44,501,004	S207A	probably damaging	Het
Fat3	T	A	9: 16,376,923	K435*	probably null	Het
Fsip2	T	C	2: 82,986,564	C4214R	probably benign	Het
Gfral	T	C	9: 76,164,805	*394W	probably null	Het
Glis1	T	C	4: 107,619,635	S518P	probably damaging	Het
H2-T10	A	G	17: 36,119,187		probably null	Het
Hsbp1l1	T	C	18: 80,235,464	T35A	possibly damaging	Het
Ighv5-12	A	G	12: 113,702,217	F87S	probably damaging	Het
Ints13	A	C	6: 146,576,357	D31E	probably damaging	Het
Kbtbd12	C	T	6: 88,618,627	D74N	probably damaging	Het
Klrb1c	A	G	6: 128,788,914		probably benign	Het
Kmt5b	A	T	19: 3,786,538	H25L	probably benign	Het
Krt28	A	T	11: 99,371,384	M260K	probably damaging	Het
Krt79	A	G	15: 101,929,785	S512P	probably damaging	Het
Lama1	A	T	17: 67,768,298		probably null	Het
Maneal	T	C	4: 124,857,144	E273G	possibly damaging	Het
Map4k3	T	A	17: 80,663,998	Y80F	possibly damaging	Het
Mbd6	A	G	10: 127,283,428	V946A	possibly damaging	Het
Mfsd14b	A	T	13: 65,072,122		probably null	Het
Mrpl46	C	G	7: 78,780,494	W176S	probably damaging	Het
Muc19	A	G	15: 91,884,274		noncoding transcript	Het
Mup3	T	G	4: 62,084,572	E184A	possibly damaging	Het
Myo9a	A	G	9: 59,874,628	H1699R	probably benign	Het
Ndrg2	T	A	14: 51,906,963	T269S	probably damaging	Het
Nfatc1	A	T	18: 80,649,822	V688D	probably benign	Het
Ninj2	T	C	6: 120,198,709	I101T	probably benign	Het
Nlrp10	T	A	7: 108,924,261	M671L	probably benign	Het
Npsr1	T	A	9: 24,313,214	L296I	probably damaging	Het
Olfr582	G	T	7: 103,042,310	R272L	possibly damaging	Het
Olfr975	A	G	9: 39,950,687	L28P	probably benign	Het
Pacsin1	T	A	17: 27,708,048	D242E	probably damaging	Het
Pcdh1	T	C	18: 38,197,367	Y861C	probably damaging	Het
Pcdha12	T	C	18: 37,020,390	L54P	probably damaging	Het
Pcdhb18	T	A	18: 37,491,800	S728T	probably benign	Het
Phyhd1	T	A	2: 30,277,010	H108Q	probably damaging	Het
Plcb1	A	T	2: 135,370,593	I1035F	probably damaging	Het
Plcl1	T	C	1: 55,696,150	S217P	possibly damaging	Het
Plppr2	G	A	9: 21,941,129	R103H	probably damaging	Het
Plxnb2	G	A	15: 89,157,435	T1722I	probably damaging	Het
Pole3	T	C	4: 62,524,431	N53S	probably damaging	Het
Ptk6	A	T	2: 181,199,695	N140K	possibly damaging	Het
Rab12	C	T	17: 66,497,423	R180H	probably damaging	Het
Rab36	G	T	10: 75,052,479	V252L	probably benign	Het
Ranbp3	T	C	17: 56,701,543		probably null	Het
Rapgef2	A	G	3: 79,104,001	L259P	probably damaging	Het
Scaf4	GGCTGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTGCTG	16: 90,229,857		probably benign	Het
Scd2	T	C	19: 44,299,703	F178S	probably damaging	Het
Shmt2	A	G	10: 127,520,381	S87P	probably damaging	Het
Slf1	T	A	13: 77,046,704	D834V	probably damaging	Het
Sorcs2	A	C	5: 36,046,530	Y540*	probably null	Het
Srpk2	T	A	5: 23,525,699	Q274L	possibly damaging	Het
Stradb	T	A	1: 58,992,742	M271K	possibly damaging	Het
Tfec	T	A	6: 16,867,593	Q16L	possibly damaging	Het
Tfg	T	C	16: 56,701,087	T63A	probably benign	Het
Ticrr	G	A	7: 79,689,967		probably null	Het
Ticrr	T	A	7: 79,695,296	C1636*	probably null	Het
Tln2	A	G	9: 67,311,865	I266T	probably damaging	Het
Tmcc1	G	C	6: 116,022,110	R323G	possibly damaging	Het
Tnnt3	A	G	7: 142,512,040	E138G	probably damaging	Het
Tpm2	C	A	4: 43,522,692	E75*	probably null	Het
Ttn	T	G	2: 76,750,578	T23324P	probably damaging	Het
Ubr4	T	G	4: 139,392,038	L176R	probably damaging	Het
Uhrf2	G	T	19: 30,039,088	D46Y	probably damaging	Het
Ulbp1	A	C	10: 7,473,281	S21A	unknown	Het
Usp17lb	C	T	7: 104,841,208	G170R	probably damaging	Het
Utp15	T	C	13: 98,257,925	N153S	probably benign	Het
Vcan	T	A	13: 89,688,671	E2918V	probably damaging	Het
Vmn1r174	T	A	7: 23,754,494	I195K	probably damaging	Het
Vmn1r76	C	T	7: 11,931,135	V16I	probably benign	Het
Xdh	T	C	17: 73,943,885	D24G	possibly damaging	Het
Xylb	T	A	9: 119,361,132	H68Q	probably benign	Het

Other mutations in Cilp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Cilp	APN	9	65278983	missense	possibly damaging	0.80
IGL01340:Cilp	APN	9	65275974	missense	probably damaging	0.99
IGL02330:Cilp	APN	9	65274522	splice site	probably benign
IGL02729:Cilp	APN	9	65278090	missense	possibly damaging	0.63
IGL02833:Cilp	APN	9	65277924	missense	probably benign
IGL02961:Cilp	APN	9	65278609	missense	possibly damaging	0.88
IGL03137:Cilp	APN	9	65278168	missense	probably benign
IGL03211:Cilp	APN	9	65280175	missense	probably benign
IGL03301:Cilp	APN	9	65280217	missense	probably benign	0.01
IGL03341:Cilp	APN	9	65278002	missense	probably benign	0.07
ANU05:Cilp	UTSW	9	65278983	missense	possibly damaging	0.80
IGL02984:Cilp	UTSW	9	65280130	frame shift	probably null
IGL02988:Cilp	UTSW	9	65280130	frame shift	probably null
IGL02991:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03014:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03050:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03054:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03055:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03097:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03098:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03134:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03138:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03147:Cilp	UTSW	9	65280130	frame shift	probably null
R0096:Cilp	UTSW	9	65273670	missense	possibly damaging	0.57
R0219:Cilp	UTSW	9	65269590	missense	possibly damaging	0.64
R0347:Cilp	UTSW	9	65280153	missense	probably benign
R0699:Cilp	UTSW	9	65270326	missense	probably damaging	1.00
R1148:Cilp	UTSW	9	65280316	missense	possibly damaging	0.96
R1148:Cilp	UTSW	9	65280316	missense	possibly damaging	0.96
R1155:Cilp	UTSW	9	65269587	missense	probably benign	0.01
R1544:Cilp	UTSW	9	65275845	missense	probably benign	0.03
R1584:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R1586:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R2055:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R2069:Cilp	UTSW	9	65278090	missense	possibly damaging	0.63
R2070:Cilp	UTSW	9	65279095	missense	probably damaging	1.00
R2414:Cilp	UTSW	9	65274645	splice site	probably benign
R4284:Cilp	UTSW	9	65278278	missense	probably damaging	1.00
R4630:Cilp	UTSW	9	65279880	missense	probably benign	0.17
R4632:Cilp	UTSW	9	65279880	missense	probably benign	0.17
R4870:Cilp	UTSW	9	65279698	missense	probably damaging	1.00
R4908:Cilp	UTSW	9	65278020	missense	probably benign	0.17
R5621:Cilp	UTSW	9	65278791	missense	possibly damaging	0.71
R5889:Cilp	UTSW	9	65280343	missense	possibly damaging	0.93
R6645:Cilp	UTSW	9	65279305	missense	possibly damaging	0.66
R6878:Cilp	UTSW	9	65279847	missense	probably damaging	1.00
R6982:Cilp	UTSW	9	65279805	missense	probably damaging	1.00
R7330:Cilp	UTSW	9	65280245	missense	probably benign
R7967:Cilp	UTSW	9	65278212	missense	possibly damaging	0.80
R8305:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8306:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8307:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8308:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8386:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8407:Cilp	UTSW	9	65274616	missense	probably damaging	1.00
R8542:Cilp	UTSW	9	65278123	missense	probably damaging	1.00
R8794:Cilp	UTSW	9	65279253	missense	probably benign	0.26
R8951:Cilp	UTSW	9	65272938	missense	probably benign	0.01
R9060:Cilp	UTSW	9	65279020	missense	probably benign	0.01
R9257:Cilp	UTSW	9	65267169	missense	possibly damaging	0.72
R9265:Cilp	UTSW	9	65280051	missense	probably benign
R9358:Cilp	UTSW	9	65275987	missense	probably benign
R9401:Cilp	UTSW	9	65278099	missense	probably damaging	0.98
X0024:Cilp	UTSW	9	65279643	missense	probably damaging	1.00
X0025:Cilp	UTSW	9	65279698	missense	probably damaging	1.00
Z1088:Cilp	UTSW	9	65280130	frame shift	probably null
Z1176:Cilp	UTSW	9	65280130	frame shift	probably null
Z1177:Cilp	UTSW	9	65280130	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTTCCAGTACCTCCAAAG -3'
(R):5'- GCAGACGTTTACCAATTCCTTTTG -3'

Sequencing Primer
(F):5'- GTCCCCAGCTACAGGCAC -3'
(R):5'- GTGGCAATCAGCATCATG -3'

Posted On

2016-10-24