Incidental Mutation 'R5568:Ddx24'
ID 437050
Institutional Source Beutler Lab
Gene Symbol Ddx24
Ensembl Gene ENSMUSG00000041645
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Synonyms 2510027P10Rik, 1700055J08Rik
MMRRC Submission 043125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5568 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 103407982-103425830 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103424288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 59 (Q59L)
Ref Sequence ENSEMBL: ENSMUSP00000152366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044923] [ENSMUST00000110001] [ENSMUST00000220975] [ENSMUST00000221211] [ENSMUST00000223233]
AlphaFold Q9ESV0
Predicted Effect probably benign
Transcript: ENSMUST00000044923
AA Change: Q102L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040890
Gene: ENSMUSG00000041645
AA Change: Q102L

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
DEXDc 212 541 1.14e-39 SMART
HELICc 601 682 5.22e-25 SMART
low complexity region 752 766 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110001
AA Change: Q148L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105628
Gene: ENSMUSG00000041645
AA Change: Q148L

DomainStartEndE-ValueType
low complexity region 140 147 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
low complexity region 214 226 N/A INTRINSIC
DEXDc 258 587 1.14e-39 SMART
HELICc 647 728 5.22e-25 SMART
low complexity region 798 812 N/A INTRINSIC
low complexity region 821 833 N/A INTRINSIC
low complexity region 881 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220705
Predicted Effect possibly damaging
Transcript: ENSMUST00000220975
AA Change: Q59L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000221211
AA Change: Q102L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000223233
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which shows little similarity to any of the other known human DEAD box proteins, but shows a high similarity to mouse Ddx24 at the amino acid level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal: embryos die between implantation and placentation. Heterozygous KO animals are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Clp1 T A 2: 84,725,978 K53* probably null Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Ddx58 T A 4: 40,222,140 M380L probably benign Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
Glis1 T C 4: 107,619,635 S518P probably damaging Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Nfatc1 A T 18: 80,649,822 V688D probably benign Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Ptk6 A T 2: 181,199,695 N140K possibly damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Sorcs2 A C 5: 36,046,530 Y540* probably null Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Stradb T A 1: 58,992,742 M271K possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Ddx24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Ddx24 APN 12 103418202 missense probably damaging 0.97
IGL02102:Ddx24 APN 12 103408484 intron probably benign
IGL02225:Ddx24 APN 12 103417371 missense probably damaging 1.00
IGL02226:Ddx24 APN 12 103424458 missense possibly damaging 0.81
IGL02325:Ddx24 APN 12 103416266 missense probably damaging 1.00
IGL02568:Ddx24 APN 12 103417312 missense probably damaging 1.00
IGL02666:Ddx24 APN 12 103424055 missense possibly damaging 0.94
IGL02950:Ddx24 APN 12 103417542 missense probably damaging 1.00
IGL03244:Ddx24 APN 12 103417605 missense possibly damaging 0.53
P0028:Ddx24 UTSW 12 103408375 missense probably benign
R0195:Ddx24 UTSW 12 103418961 critical splice donor site probably null
R0540:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0607:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0621:Ddx24 UTSW 12 103425558 intron probably benign
R0964:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R1447:Ddx24 UTSW 12 103424307 missense possibly damaging 0.88
R1639:Ddx24 UTSW 12 103411319 critical splice acceptor site probably null
R1909:Ddx24 UTSW 12 103409982 missense probably damaging 0.99
R2418:Ddx24 UTSW 12 103417737 missense probably damaging 1.00
R3706:Ddx24 UTSW 12 103417416 missense probably damaging 1.00
R3725:Ddx24 UTSW 12 103417605 missense probably benign 0.19
R4436:Ddx24 UTSW 12 103423974 missense probably damaging 1.00
R4807:Ddx24 UTSW 12 103419461 missense probably damaging 1.00
R5629:Ddx24 UTSW 12 103425547 intron probably benign
R5763:Ddx24 UTSW 12 103417414 missense probably damaging 1.00
R5891:Ddx24 UTSW 12 103424058 missense probably damaging 1.00
R6059:Ddx24 UTSW 12 103408300 missense probably damaging 1.00
R6310:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6311:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6408:Ddx24 UTSW 12 103425560 intron probably benign
R6648:Ddx24 UTSW 12 103408375 missense probably benign 0.02
R7151:Ddx24 UTSW 12 103424088 missense probably benign 0.00
R7299:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7301:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7324:Ddx24 UTSW 12 103416259 missense probably damaging 1.00
R7513:Ddx24 UTSW 12 103419106 nonsense probably null
R7602:Ddx24 UTSW 12 103416260 nonsense probably null
R7734:Ddx24 UTSW 12 103417560 missense possibly damaging 0.49
R8076:Ddx24 UTSW 12 103416218 missense probably damaging 1.00
R8466:Ddx24 UTSW 12 103409901 missense probably benign 0.01
R8914:Ddx24 UTSW 12 103424406 missense possibly damaging 0.86
R9484:Ddx24 UTSW 12 103411296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGCCTTCTGGTCGTG -3'
(R):5'- CCTGGTGTGCTTTGAAGAGC -3'

Sequencing Primer
(F):5'- GTGCACCTCAGCCATCCATG -3'
(R):5'- GTGCTTTGAAGAGCTGACAGATTACC -3'
Posted On 2016-10-24