Incidental Mutation 'R0046:Vmn2r77'
ID43707
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Namevomeronasal 2, receptor 77
SynonymsEG546983
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86795141-86812032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86801938 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 344 (D344G)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164996
AA Change: D344G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: D344G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86800767 missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86811664 missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86811916 missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86811649 missense probably benign
IGL01805:Vmn2r77 APN 7 86811187 missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86803016 missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86801470 missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86801555 missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86803628 nonsense probably null
IGL02185:Vmn2r77 APN 7 86795152 missense unknown
IGL02200:Vmn2r77 APN 7 86801979 missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86802016 missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86803640 nonsense probably null
IGL02557:Vmn2r77 APN 7 86795134 unclassified probably benign
IGL02659:Vmn2r77 APN 7 86800771 missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86811347 missense probably benign
IGL03180:Vmn2r77 APN 7 86801635 missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86811923 missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86811286 missense probably damaging 0.99
R0047:Vmn2r77 UTSW 7 86811650 missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86811175 missense probably benign
R0689:Vmn2r77 UTSW 7 86811664 missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86802016 missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86801746 missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86801034 critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86802186 missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86811148 missense probably damaging 1.00
R1654:Vmn2r77 UTSW 7 86811915 missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86795335 missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86801613 missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86811793 missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86801713 missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86811944 missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86811689 missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86800983 missense probably benign
R3694:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86795160 nonsense probably null
R3870:Vmn2r77 UTSW 7 86811842 missense probably damaging 1.00
R4732:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R4733:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86801807 missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86811638 missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86802133 missense probably damaging 0.98
R5469:Vmn2r77 UTSW 7 86802063 missense probably benign 0.01
R5673:Vmn2r77 UTSW 7 86812006 missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86812027 missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86811462 nonsense probably null
R5899:Vmn2r77 UTSW 7 86811716 missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86801670 missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86811749 missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86801823 missense probably benign
R6419:Vmn2r77 UTSW 7 86811559 missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86800857 missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86802078 missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86802994 missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86801815 missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86801827 missense probably benign 0.00
R7261:Vmn2r77 UTSW 7 86811310 nonsense probably null
R7298:Vmn2r77 UTSW 7 86800771 missense probably benign 0.00
R7662:Vmn2r77 UTSW 7 86811284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCATCAGCAAAAGTTGTCGTCGTC -3'
(R):5'- TGGGCAGCAGCATACACAGAATTG -3'

Sequencing Primer
(F):5'- TCGTCGTCTATGGGGATAAAGAATC -3'
(R):5'- CAGCAGCATACACAGAATTGTATAAG -3'
Posted On2013-05-29