Incidental Mutation 'R5574:Stam'
ID437083
Institutional Source Beutler Lab
Gene Symbol Stam
Ensembl Gene ENSMUSG00000026718
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 1
SynonymsSTAM1
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R5574 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14074098-14149634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14115864 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 58 (D58G)
Ref Sequence ENSEMBL: ENSMUSP00000100025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028050] [ENSMUST00000102960] [ENSMUST00000138989] [ENSMUST00000193636]
Predicted Effect probably damaging
Transcript: ENSMUST00000028050
AA Change: D58G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028050
Gene: ENSMUSG00000026718
AA Change: D58G

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
PDB:3F1I|C 301 377 9e-46 PDB
low complexity region 387 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102960
AA Change: D58G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100025
Gene: ENSMUSG00000026718
AA Change: D58G

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
Pfam:GAT 304 377 6.8e-10 PFAM
low complexity region 387 404 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138989
AA Change: D55G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121228
Gene: ENSMUSG00000026718
AA Change: D55G

DomainStartEndE-ValueType
VHS 4 136 1.76e-59 SMART
UIM 168 187 1.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156901
Predicted Effect probably benign
Transcript: ENSMUST00000193636
SMART Domains Protein: ENSMUSP00000141207
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
Pfam:VHS 5 44 2e-8 PFAM
Meta Mutation Damage Score 0.6450 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-transducing adaptor molecule family. These proteins mediate downstream signaling of cytokine receptors and also play a role in ER to Golgi trafficking by interacting with the coat protein II complex. The encoded protein also associates with hepatocyte growth factor-regulated substrate to form the endosomal sorting complex required for transport-0 (ESCRT-0), which sorts ubiquitinated membrane proteins to the ESCRT-1 complex for lysosomal degradation. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive growth retardation, priapism, male infertility, degeneration of hippocapal CA3 pyramidal neurons and premature death, but exhibit normal lymphocyte development, proliferation and responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Stam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Stam APN 2 14115968 intron probably benign
IGL02964:Stam APN 2 14115968 intron probably benign
IGL03365:Stam APN 2 14146390 nonsense probably null
R0058:Stam UTSW 2 14138141 missense probably damaging 1.00
R0410:Stam UTSW 2 14138991 missense probably benign 0.04
R0479:Stam UTSW 2 14117495 missense probably damaging 1.00
R1018:Stam UTSW 2 14117374 splice site probably benign
R1554:Stam UTSW 2 14141828 missense probably benign
R1631:Stam UTSW 2 14146248 nonsense probably null
R1897:Stam UTSW 2 14129026 missense probably damaging 1.00
R3735:Stam UTSW 2 14129012 missense probably damaging 1.00
R3973:Stam UTSW 2 14138961 missense probably damaging 1.00
R4610:Stam UTSW 2 14115858 missense probably damaging 1.00
R4914:Stam UTSW 2 14102416 missense probably damaging 1.00
R5079:Stam UTSW 2 14074539 missense probably benign
R5209:Stam UTSW 2 14146347 missense probably benign 0.04
R5636:Stam UTSW 2 14117427 missense probably damaging 1.00
R6968:Stam UTSW 2 14116018 missense probably damaging 1.00
R7384:Stam UTSW 2 14134430 missense probably benign 0.17
R8127:Stam UTSW 2 14117473 missense probably damaging 0.99
Z1088:Stam UTSW 2 14139090 nonsense probably null
Z1176:Stam UTSW 2 14116013 missense probably damaging 1.00
Z1176:Stam UTSW 2 14128564 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGCTAAGCAAGAACATGTGTTAC -3'
(R):5'- GCTTACTTCACTAGCAAAGTCTC -3'

Sequencing Primer
(F):5'- CCTTTGGAAAGCTTAAAGGACCTAGC -3'
(R):5'- CTTCACTAGCAAAGTCTCTTGAAC -3'
Posted On2016-10-26