Mutagenetix > Incidental Mutations

Incidental Mutation 'R5574:Rapgef4'

ID

437086

Institutional Source

Beutler Lab

Gene Symbol

Rapgef4

Ensembl Gene

ENSMUSG00000049044

Gene Name

Rap guanine nucleotide exchange factor (GEF) 4

Synonyms

cAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik

MMRRC Submission

043129-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.573) question?

question?

Stock #

R5574 (G1)

Quality Score

225

Status

Validated

Chromosome

2

Chromosomal Location

71981240-72257474 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 72034120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090826] [ENSMUST00000090826] [ENSMUST00000090826] [ENSMUST00000102698] [ENSMUST00000102698] [ENSMUST00000102698] [ENSMUST00000102698] [ENSMUST00000102698] [ENSMUST00000102698]

Predicted Effect

probably null
Transcript: ENSMUST00000090826

SMART Domains

Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	216	291	3.43e-27	SMART
low complexity region	302	311	N/A	INTRINSIC
cNMP	356	475	4.02e-15	SMART
RasGEFN	495	630	3.61e-7	SMART
Blast:RasGEF	678	751	2e-33	BLAST
RasGEF	768	1010	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000090826

SMART Domains

Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	216	291	3.43e-27	SMART
low complexity region	302	311	N/A	INTRINSIC
cNMP	356	475	4.02e-15	SMART
RasGEFN	495	630	3.61e-7	SMART
Blast:RasGEF	678	751	2e-33	BLAST
RasGEF	768	1010	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000090826

SMART Domains

Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	216	291	3.43e-27	SMART
low complexity region	302	311	N/A	INTRINSIC
cNMP	356	475	4.02e-15	SMART
RasGEFN	495	630	3.61e-7	SMART
Blast:RasGEF	678	751	2e-33	BLAST
RasGEF	768	1010	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102698

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102698

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102698

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102698

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102698

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102698

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149421

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150234

Meta Mutation Damage Score

0.9486

question?

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,756	N31I	possibly damaging	Het
3110002H16Rik	CTGTGTGTT	CTGTGTGTTGTGTGTT	18: 12,185,006		probably null	Het
Acvr1b	T	A	15: 101,202,077	M304K	probably benign	Het
Adamts1	G	T	16: 85,799,642	D106E	probably damaging	Het
Blm	C	A	7: 80,499,773	C696F	probably damaging	Het
Bnip3l-ps	T	A	12: 18,217,118		noncoding transcript	Het
C87499	T	G	4: 88,628,043	E354A	probably benign	Het
Ccdc171	A	T	4: 83,693,753	N895I	probably damaging	Het
Cdhr4	A	T	9: 107,993,328		probably benign	Het
Cfap97	T	C	8: 46,170,142	S190P	probably damaging	Het
Chrnb1	A	C	11: 69,793,683		probably benign	Het
Clns1a	A	G	7: 97,720,958		probably benign	Het
Col8a2	G	A	4: 126,311,268		probably benign	Het
Cr2	T	A	1: 195,141,236	E721V	probably damaging	Het
Csk	A	G	9: 57,629,301	V172A	probably benign	Het
Cyp2g1	G	A	7: 26,820,740	V466M	possibly damaging	Het
Cyp4f13	A	G	17: 32,929,205	Y349H	probably benign	Het
Dnm1l	T	C	16: 16,329,821	Y205C	probably damaging	Het
Dync1i2	A	T	2: 71,233,650	T113S	probably benign	Het
Edem2	T	C	2: 155,716,155	E186G	probably damaging	Het
Eya2	G	A	2: 165,763,816	R380H	probably damaging	Het
Fam214a	A	T	9: 75,010,390	D757V	probably damaging	Het
Fam60a	C	T	6: 148,944,880		probably benign	Het
Gldn	A	G	9: 54,312,922	T132A	probably damaging	Het
Gm13941	A	T	2: 111,100,606	I74K	unknown	Het
Gm3898	C	T	9: 43,830,042		noncoding transcript	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Klhdc10	C	T	6: 30,439,865	L127F	possibly damaging	Het
Letm1	G	A	5: 33,769,386	T189M	possibly damaging	Het
Lrrc17	A	T	5: 21,570,357	I306F	possibly damaging	Het
Lrrk2	T	A	15: 91,787,016	V2000E	probably damaging	Het
Mettl9	A	T	7: 121,047,870	E66D	probably benign	Het
Mroh1	T	A	15: 76,433,931	V877D	probably benign	Het
Mycbp2	C	T	14: 103,142,767	V3760M	possibly damaging	Het
Nos3	A	G	5: 24,368,861	T208A	possibly damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Obp2a	A	T	2: 25,700,830	T70S	possibly damaging	Het
Olfr1040	T	C	2: 86,146,191	D181G	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr1245	C	T	2: 89,574,977	V250I	possibly damaging	Het
Olfr145	A	T	9: 37,897,581	Y59F	probably damaging	Het
Olfr69	T	G	7: 103,768,116	I94L	possibly damaging	Het
Pate2	A	G	9: 35,686,115		probably benign	Het
Pdzph1	A	G	17: 58,973,947	F447L	probably benign	Het
Pias1	A	G	9: 62,920,493	C211R	probably damaging	Het
Plb1	A	G	5: 32,329,947	S929G	probably benign	Het
Prc1	G	A	7: 80,294,542		probably benign	Het
Prex2	A	G	1: 11,140,058	D574G	probably damaging	Het
Rock2	T	C	12: 16,961,641	M690T	possibly damaging	Het
Slc18a2	A	G	19: 59,261,405	I25V	probably benign	Het
Slc9a5	T	A	8: 105,364,691	I701K	probably benign	Het
Sorcs1	T	A	19: 50,222,133	N765Y	probably damaging	Het
Ssh2	A	T	11: 77,450,115	I698L	probably benign	Het
Stam	A	G	2: 14,115,864	D58G	probably damaging	Het
Thsd4	C	A	9: 59,972,400	R1018L	probably damaging	Het
Tnxb	A	G	17: 34,711,024	T2911A	probably benign	Het
Trpm7	A	C	2: 126,813,030	F1329L	probably benign	Het
Ttll9	A	G	2: 152,984,248	E126G	possibly damaging	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Unc45a	G	A	7: 80,334,856	A232V	probably damaging	Het
Utp14b	G	A	1: 78,666,409	V675M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,891	H279L	probably benign	Het
Vmn2r75	G	T	7: 86,166,302	A118E	probably benign	Het
Wdr36	A	T	18: 32,865,959	Q886L	probably damaging	Het
Zfp433	T	A	10: 81,719,291	Y27*	probably null	Het
Zfp715	A	T	7: 43,311,039	S43T	possibly damaging	Het
Zfyve26	A	G	12: 79,239,924	S2297P	possibly damaging	Het

Other mutations in Rapgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rapgef4	APN	2	72256312	missense	possibly damaging	0.75
IGL00858:Rapgef4	APN	2	72198897	missense	probably damaging	1.00
IGL01408:Rapgef4	APN	2	72174841	nonsense	probably null
IGL01673:Rapgef4	APN	2	72241437	missense	probably damaging	0.99
IGL01678:Rapgef4	APN	2	72242225	splice site	probably benign
IGL01725:Rapgef4	APN	2	72174874	missense	probably benign	0.24
IGL01871:Rapgef4	APN	2	72198360	missense	possibly damaging	0.69
IGL01935:Rapgef4	APN	2	72234123	missense	probably benign	0.05
IGL02001:Rapgef4	APN	2	72225052	splice site	probably benign
IGL02041:Rapgef4	APN	2	72198796	missense	probably damaging	1.00
IGL02134:Rapgef4	APN	2	72180061	missense	probably damaging	0.97
IGL02410:Rapgef4	APN	2	72226594	missense	possibly damaging	0.51
IGL02807:Rapgef4	APN	2	72205649	splice site	probably benign
IGL03066:Rapgef4	APN	2	72141179	splice site	probably benign
IGL03282:Rapgef4	APN	2	72205752	splice site	probably benign
IGL03291:Rapgef4	APN	2	72195703	missense	probably damaging	1.00
P0033:Rapgef4	UTSW	2	72137331	intron	probably benign
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0309:Rapgef4	UTSW	2	72226030	missense	probably benign	0.02
R0398:Rapgef4	UTSW	2	72031041	missense	probably damaging	0.99
R0747:Rapgef4	UTSW	2	72223073	missense	possibly damaging	0.66
R1216:Rapgef4	UTSW	2	72208148	missense	possibly damaging	0.51
R1264:Rapgef4	UTSW	2	72031105	missense	possibly damaging	0.48
R1302:Rapgef4	UTSW	2	72045160	missense	probably benign	0.31
R1460:Rapgef4	UTSW	2	72031176	critical splice donor site	probably null
R1483:Rapgef4	UTSW	2	72055026	critical splice donor site	probably null
R1682:Rapgef4	UTSW	2	72226568	missense	possibly damaging	0.80
R1768:Rapgef4	UTSW	2	72225787	splice site	probably benign
R1858:Rapgef4	UTSW	2	72031064	missense	possibly damaging	0.67
R1860:Rapgef4	UTSW	2	72234720	missense	probably benign	0.05
R1952:Rapgef4	UTSW	2	72208127	missense	probably benign	0.07
R2025:Rapgef4	UTSW	2	72242739	missense	probably benign	0.01
R2128:Rapgef4	UTSW	2	72226553	missense	possibly damaging	0.87
R2159:Rapgef4	UTSW	2	72174881	missense	probably damaging	1.00
R2201:Rapgef4	UTSW	2	72045189	missense	probably damaging	0.96
R2883:Rapgef4	UTSW	2	72031125	missense	probably benign
R3015:Rapgef4	UTSW	2	72198373	missense	probably damaging	1.00
R4278:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R5256:Rapgef4	UTSW	2	72034034	missense	probably damaging	0.97
R5572:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5575:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5749:Rapgef4	UTSW	2	72242757	missense	probably damaging	1.00
R6007:Rapgef4	UTSW	2	72179949	missense	possibly damaging	0.55
R6084:Rapgef4	UTSW	2	72196278	critical splice donor site	probably null
R6192:Rapgef4	UTSW	2	71981317	missense	probably benign	0.00
R6409:Rapgef4	UTSW	2	72178237	missense	probably benign	0.01
R6683:Rapgef4	UTSW	2	72054779	intron	probably benign
R6774:Rapgef4	UTSW	2	72225775	missense	probably benign	0.01
R6844:Rapgef4	UTSW	2	72234626	missense	probably damaging	0.99
R6999:Rapgef4	UTSW	2	72239125	missense	probably damaging	1.00
R7077:Rapgef4	UTSW	2	72241476	missense	probably damaging	0.96
R7138:Rapgef4	UTSW	2	72198363	missense	probably damaging	1.00
R7275:Rapgef4	UTSW	2	72208101	missense	probably damaging	1.00
R7352:Rapgef4	UTSW	2	72180091	missense	probably damaging	1.00
R7397:Rapgef4	UTSW	2	72205666	missense	probably benign	0.23
R7508:Rapgef4	UTSW	2	72205733	missense	probably benign	0.00
R7620:Rapgef4	UTSW	2	72229078	missense	probably damaging	0.99
R7703:Rapgef4	UTSW	2	72179971	missense	probably benign	0.28
R7770:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R7814:Rapgef4	UTSW	2	72223117	missense	probably benign
R7868:Rapgef4	UTSW	2	72201137	missense	probably benign	0.11
R8210:Rapgef4	UTSW	2	72226020	missense	probably benign	0.00
R8967:Rapgef4	UTSW	2	72226510	missense	possibly damaging	0.72
R9113:Rapgef4	UTSW	2	72031149	missense	probably benign	0.43
R9157:Rapgef4	UTSW	2	72174868	missense	probably benign	0.06
R9314:Rapgef4	UTSW	2	72234639	missense	possibly damaging	0.52
X0062:Rapgef4	UTSW	2	72226607	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CATGGCCAGTGGGGATCTAT -3'
(R):5'- TGTGGTAGACAAGGTCATGAAT -3'

Sequencing Primer
(F):5'- TCAGGTTGCAGTCATCAAACCTG -3'
(R):5'- GCTGGTAATGGTGTAAATACAGTAC -3'

Posted On

2016-10-26