Incidental Mutation 'R5574:Olfr1100'
ID 437088
Institutional Source Beutler Lab
Gene Symbol Olfr1100
Ensembl Gene ENSMUSG00000070875
Gene Name olfactory receptor 1100
Synonyms GA_x6K02T2Q125-48465387-48464422, MOR206-4
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 86976029-86979954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86978523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000151088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094913] [ENSMUST00000117211]
AlphaFold Q8VFM1
Predicted Effect probably benign
Transcript: ENSMUST00000094913
AA Change: V91A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092517
Gene: ENSMUSG00000070875
AA Change: V91A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 314 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117211
AA Change: V91A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Olfr1100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Olfr1100 APN 2 86977849 nonsense probably null
R0102:Olfr1100 UTSW 2 86978205 missense possibly damaging 0.90
R0477:Olfr1100 UTSW 2 86978223 missense probably damaging 0.99
R0586:Olfr1100 UTSW 2 86978782 missense probably damaging 0.99
R0743:Olfr1100 UTSW 2 86978499 missense probably benign 0.12
R1163:Olfr1100 UTSW 2 86978676 missense probably damaging 1.00
R1640:Olfr1100 UTSW 2 86978619 missense probably damaging 1.00
R2865:Olfr1100 UTSW 2 86978461 missense possibly damaging 0.56
R4478:Olfr1100 UTSW 2 86978218 missense probably benign
R4548:Olfr1100 UTSW 2 86978670 missense probably damaging 0.98
R4618:Olfr1100 UTSW 2 86978274 missense possibly damaging 0.87
R4829:Olfr1100 UTSW 2 86978574 missense probably damaging 0.99
R4858:Olfr1100 UTSW 2 86978349 missense probably damaging 1.00
R5071:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5072:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5073:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5074:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5735:Olfr1100 UTSW 2 86978700 missense probably benign 0.08
R5874:Olfr1100 UTSW 2 86978442 missense probably damaging 0.99
R6228:Olfr1100 UTSW 2 86978691 missense probably damaging 1.00
R6689:Olfr1100 UTSW 2 86978154 missense probably benign 0.36
R6979:Olfr1100 UTSW 2 86978233 missense probably damaging 1.00
R7006:Olfr1100 UTSW 2 86977959 missense probably damaging 0.99
R7274:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R7399:Olfr1100 UTSW 2 86978157 missense probably benign 0.19
R7560:Olfr1100 UTSW 2 86978778 missense probably benign 0.00
R7765:Olfr1100 UTSW 2 86978194 missense probably damaging 0.98
R8381:Olfr1100 UTSW 2 86978029 missense probably benign 0.36
R8390:Olfr1100 UTSW 2 86978157 missense probably benign 0.19
R8694:Olfr1100 UTSW 2 86978247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGTTCTGCAGAAATATAAGGTG -3'
(R):5'- ATATACCTGGTCACTGTGCTGG -3'

Sequencing Primer
(F):5'- GTTCCAATCATATAGGAACCAGTGAG -3'
(R):5'- TCACTGTGCTGGGGAACG -3'
Posted On 2016-10-26