Incidental Mutation 'R5574:Or4a72'
ID 437089
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 043129-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89405321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 250 (V250I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000099766
AA Change: V250I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: V250I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214870
AA Change: V250I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217402
AA Change: V250I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,380,205 (GRCm39) N31I possibly damaging Het
Acvr1b T A 15: 101,099,958 (GRCm39) M304K probably benign Het
Adamts1 G T 16: 85,596,530 (GRCm39) D106E probably damaging Het
Atosa A T 9: 74,917,672 (GRCm39) D757V probably damaging Het
Blm C A 7: 80,149,521 (GRCm39) C696F probably damaging Het
Bnip3l-ps T A 12: 18,267,119 (GRCm39) noncoding transcript Het
Ccdc171 A T 4: 83,611,990 (GRCm39) N895I probably damaging Het
Cdhr4 A T 9: 107,870,527 (GRCm39) probably benign Het
Cfap97 T C 8: 46,623,179 (GRCm39) S190P probably damaging Het
Chrnb1 A C 11: 69,684,509 (GRCm39) probably benign Het
Clns1a A G 7: 97,370,165 (GRCm39) probably benign Het
Col8a2 G A 4: 126,205,061 (GRCm39) probably benign Het
Cr2 T A 1: 194,823,544 (GRCm39) E721V probably damaging Het
Csk A G 9: 57,536,584 (GRCm39) V172A probably benign Het
Cyp2g1 G A 7: 26,520,165 (GRCm39) V466M possibly damaging Het
Cyp4f13 A G 17: 33,148,179 (GRCm39) Y349H probably benign Het
Dnm1l T C 16: 16,147,685 (GRCm39) Y205C probably damaging Het
Dync1i2 A T 2: 71,063,994 (GRCm39) T113S probably benign Het
Edem2 T C 2: 155,558,075 (GRCm39) E186G probably damaging Het
Eya2 G A 2: 165,605,736 (GRCm39) R380H probably damaging Het
Gldn A G 9: 54,220,206 (GRCm39) T132A probably damaging Het
Gm13941 A T 2: 110,930,951 (GRCm39) I74K unknown Het
Gm3898 C T 9: 43,741,339 (GRCm39) noncoding transcript Het
Ighmbp2 C T 19: 3,321,536 (GRCm39) V408I probably benign Het
Klhdc10 C T 6: 30,439,864 (GRCm39) L127F possibly damaging Het
Letm1 G A 5: 33,926,730 (GRCm39) T189M possibly damaging Het
Lrrc17 A T 5: 21,775,355 (GRCm39) I306F possibly damaging Het
Lrrk2 T A 15: 91,671,219 (GRCm39) V2000E probably damaging Het
Mettl9 A T 7: 120,647,093 (GRCm39) E66D probably benign Het
Mroh1 T A 15: 76,318,131 (GRCm39) V877D probably benign Het
Mycbp2 C T 14: 103,380,203 (GRCm39) V3760M possibly damaging Het
Nos3 A G 5: 24,573,859 (GRCm39) T208A possibly damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Obp2a A T 2: 25,590,842 (GRCm39) T70S possibly damaging Het
Or52a5b T G 7: 103,417,323 (GRCm39) I94L possibly damaging Het
Or5al6 T C 2: 85,976,535 (GRCm39) D181G probably damaging Het
Or8b8 A T 9: 37,808,877 (GRCm39) Y59F probably damaging Het
Or8h10 A G 2: 86,808,867 (GRCm39) V91A probably benign Het
Pate2 A G 9: 35,597,411 (GRCm39) probably benign Het
Pdzph1 A G 17: 59,280,942 (GRCm39) F447L probably benign Het
Pias1 A G 9: 62,827,775 (GRCm39) C211R probably damaging Het
Plb1 A G 5: 32,487,291 (GRCm39) S929G probably benign Het
Pramel32 T G 4: 88,546,280 (GRCm39) E354A probably benign Het
Prc1 G A 7: 79,944,290 (GRCm39) probably benign Het
Prex2 A G 1: 11,210,282 (GRCm39) D574G probably damaging Het
Rapgef4 G A 2: 71,864,464 (GRCm39) probably null Het
Rmc1 CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,318,063 (GRCm39) probably null Het
Rock2 T C 12: 17,011,642 (GRCm39) M690T possibly damaging Het
Sinhcaf C T 6: 148,846,378 (GRCm39) probably benign Het
Slc18a2 A G 19: 59,249,837 (GRCm39) I25V probably benign Het
Slc9a5 T A 8: 106,091,323 (GRCm39) I701K probably benign Het
Sorcs1 T A 19: 50,210,571 (GRCm39) N765Y probably damaging Het
Ssh2 A T 11: 77,340,941 (GRCm39) I698L probably benign Het
Stam A G 2: 14,120,675 (GRCm39) D58G probably damaging Het
Thsd4 C A 9: 59,879,683 (GRCm39) R1018L probably damaging Het
Tnxb A G 17: 34,929,998 (GRCm39) T2911A probably benign Het
Trpm7 A C 2: 126,654,950 (GRCm39) F1329L probably benign Het
Ttll9 A G 2: 152,826,168 (GRCm39) E126G possibly damaging Het
Tubgcp5 G A 7: 55,455,077 (GRCm39) V258M probably benign Het
Unc45a G A 7: 79,984,604 (GRCm39) A232V probably damaging Het
Utp14b G A 1: 78,644,126 (GRCm39) V675M probably damaging Het
Vmn2r67 T A 7: 84,801,099 (GRCm39) H279L probably benign Het
Vmn2r75 G T 7: 85,815,510 (GRCm39) A118E probably benign Het
Wdr36 A T 18: 32,999,012 (GRCm39) Q886L probably damaging Het
Zfp433 T A 10: 81,555,125 (GRCm39) Y27* probably null Het
Zfp715 A T 7: 42,960,463 (GRCm39) S43T possibly damaging Het
Zfyve26 A G 12: 79,286,698 (GRCm39) S2297P possibly damaging Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGATAGAATTTTGCACCAG -3'
(R):5'- GACTGGTGGTTTTACACACTCTC -3'

Sequencing Primer
(F):5'- GCACCAGAGCTTTTTCATACAAG -3'
(R):5'- TGGTACTTGCATGCACAGAC -3'
Posted On 2016-10-26