Incidental Mutation 'R5574:Col8a2'
ID437097
Institutional Source Beutler Lab
Gene Symbol Col8a2
Ensembl Gene ENSMUSG00000056174
Gene Namecollagen, type VIII, alpha 2
Synonyms
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R5574 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126286793-126314330 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 126311268 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000102617] [ENSMUST00000128435]
Predicted Effect unknown
Transcript: ENSMUST00000070132
AA Change: G357D
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174
AA Change: G357D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect probably benign
Transcript: ENSMUST00000128435
SMART Domains Protein: ENSMUSP00000123003
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Meta Mutation Damage Score 0.9288 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 2 chain of type VIII collagen. This protein is a major component of the basement membrane of the corneal endothelium and forms homo- or heterotrimers with alpha 1 (VIII) type collagens. Defects in this gene are associated with Fuchs endothelial corneal dystrophy and posterior polymorphous corneal dystrophy type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a thinner Descemet's membrane of the cornea. Mice heterozygous or homozygous for an ENU-induced mutation exhibit thin cornea, corneal epithelium, stroma, and Descemet membrane, and enlarged anterior chamber. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Col8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col8a2 APN 4 126309791 missense probably damaging 0.99
IGL01776:Col8a2 APN 4 126309805 unclassified probably benign
IGL03367:Col8a2 APN 4 126312198 missense probably damaging 1.00
R1861:Col8a2 UTSW 4 126311624 unclassified probably benign
R1909:Col8a2 UTSW 4 126312133 missense possibly damaging 0.63
R2038:Col8a2 UTSW 4 126311315 unclassified probably benign
R2866:Col8a2 UTSW 4 126311199 unclassified probably benign
R4013:Col8a2 UTSW 4 126311115 unclassified probably benign
R4586:Col8a2 UTSW 4 126311019 unclassified probably benign
R4995:Col8a2 UTSW 4 126310788 missense probably damaging 0.98
R5160:Col8a2 UTSW 4 126310412 missense possibly damaging 0.77
R5858:Col8a2 UTSW 4 126311300 unclassified probably benign
R6803:Col8a2 UTSW 4 126312000 missense probably damaging 1.00
Z1177:Col8a2 UTSW 4 126311543 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCAGGTTCTAGGGGAGAG -3'
(R):5'- ACCTGTAAAACCTGGCTCAC -3'

Sequencing Primer
(F):5'- TGTGGGTCCAAAAGGCCCTC -3'
(R):5'- TGTAAAACCTGGCTCACCCTTAGG -3'
Posted On2016-10-26