Incidental Mutation 'R5574:Lrrc17'
ID 437098
Institutional Source Beutler Lab
Gene Symbol Lrrc17
Ensembl Gene ENSMUSG00000039883
Gene Name leucine rich repeat containing 17
Synonyms 6130400C22Rik, 37kDa, 4833425M04Rik
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 21543559-21575904 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21570357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 306 (I306F)
Ref Sequence ENSEMBL: ENSMUSP00000038569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035651] [ENSMUST00000051358] [ENSMUST00000115234]
AlphaFold Q9CXD9
Predicted Effect possibly damaging
Transcript: ENSMUST00000035651
AA Change: I306F

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038569
Gene: ENSMUSG00000039883
AA Change: I306F

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:LRR 83 105 8e-6 BLAST
LRR 106 129 9.96e-1 SMART
LRR 130 153 1.07e0 SMART
LRRCT 165 215 8.98e-4 SMART
LRR 270 292 8.73e1 SMART
LRR 293 316 3.52e-1 SMART
LRR 317 340 7.55e-1 SMART
LRRCT 352 403 8.95e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051358
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115234
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137788
Meta Mutation Damage Score 0.2808 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Lrrc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Lrrc17 APN 5 21575271 missense probably benign 0.05
IGL01289:Lrrc17 APN 5 21560901 missense probably damaging 1.00
IGL01549:Lrrc17 APN 5 21570290 missense probably benign 0.00
IGL02105:Lrrc17 APN 5 21570257 missense probably benign 0.30
IGL02371:Lrrc17 APN 5 21560996 missense probably damaging 1.00
IGL02412:Lrrc17 APN 5 21560879 missense possibly damaging 0.68
IGL02587:Lrrc17 APN 5 21561080 missense probably damaging 1.00
R0255:Lrrc17 UTSW 5 21560969 missense probably benign 0.09
R0504:Lrrc17 UTSW 5 21560530 missense probably benign 0.05
R0883:Lrrc17 UTSW 5 21561278 missense probably benign 0.06
R1875:Lrrc17 UTSW 5 21560652 missense possibly damaging 0.85
R2168:Lrrc17 UTSW 5 21575048 missense probably damaging 0.97
R5057:Lrrc17 UTSW 5 21575309 missense probably benign 0.25
R5326:Lrrc17 UTSW 5 21575158 missense probably damaging 0.99
R5542:Lrrc17 UTSW 5 21575158 missense probably damaging 0.99
R5872:Lrrc17 UTSW 5 21575266 missense probably benign 0.01
R7108:Lrrc17 UTSW 5 21575339 missense possibly damaging 0.93
R7715:Lrrc17 UTSW 5 21561080 missense probably damaging 1.00
R7766:Lrrc17 UTSW 5 21561044 missense probably benign 0.03
R8079:Lrrc17 UTSW 5 21561071 missense probably damaging 0.99
R8121:Lrrc17 UTSW 5 21570331 missense probably benign 0.00
R9067:Lrrc17 UTSW 5 21561035 missense probably benign 0.10
X0026:Lrrc17 UTSW 5 21561020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCAGCCTCTCAGGATTAATAG -3'
(R):5'- CACATCTGAGTGTCTAACAATCCC -3'

Sequencing Primer
(F):5'- AGCCTCTCAGGATTAATAGAAACTAG -3'
(R):5'- CTATAGGTGTTGCCACAGAA -3'
Posted On 2016-10-26