Mutagenetix > Incidental Mutations

Incidental Mutation 'R5574:Nos3'

437099

Institutional Source

Beutler Lab

Gene Symbol

Nos3

Ensembl Gene

ENSMUSG00000028978

Gene Name

nitric oxide synthase 3, endothelial cell

Synonyms

eNOS, 2310065A03Rik, ecNOS, Nos-3

MMRRC Submission

043129-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24364810-24384474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24368861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 208 (T208A)

Ref Sequence

ENSEMBL: ENSMUSP00000110742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]

AlphaFold

P70313

Predicted Effect

probably benign
Transcript: ENSMUST00000030834
AA Change: T208A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: T208A

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	118	480	1.7e-183	PFAM
Pfam:Flavodoxin_1	521	697	4.8e-54	PFAM
Pfam:FAD_binding_1	750	978	2.1e-82	PFAM
Pfam:NAD_binding_1	1010	1124	1.9e-18	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115090
AA Change: T208A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: T208A

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	114	485	9e-214	PFAM
Pfam:Flavodoxin_1	521	697	3.8e-54	PFAM
Pfam:FAD_binding_1	750	978	1.6e-79	PFAM
Pfam:NAD_binding_1	1010	1091	5.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156403

Meta Mutation Damage Score

0.0717

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,756	N31I	possibly damaging	Het
3110002H16Rik	CTGTGTGTT	CTGTGTGTTGTGTGTT	18: 12,185,006		probably null	Het
Acvr1b	T	A	15: 101,202,077	M304K	probably benign	Het
Adamts1	G	T	16: 85,799,642	D106E	probably damaging	Het
Blm	C	A	7: 80,499,773	C696F	probably damaging	Het
Bnip3l-ps	T	A	12: 18,217,118		noncoding transcript	Het
C87499	T	G	4: 88,628,043	E354A	probably benign	Het
Ccdc171	A	T	4: 83,693,753	N895I	probably damaging	Het
Cdhr4	A	T	9: 107,993,328		probably benign	Het
Cfap97	T	C	8: 46,170,142	S190P	probably damaging	Het
Chrnb1	A	C	11: 69,793,683		probably benign	Het
Clns1a	A	G	7: 97,720,958		probably benign	Het
Col8a2	G	A	4: 126,311,268		probably benign	Het
Cr2	T	A	1: 195,141,236	E721V	probably damaging	Het
Csk	A	G	9: 57,629,301	V172A	probably benign	Het
Cyp2g1	G	A	7: 26,820,740	V466M	possibly damaging	Het
Cyp4f13	A	G	17: 32,929,205	Y349H	probably benign	Het
Dnm1l	T	C	16: 16,329,821	Y205C	probably damaging	Het
Dync1i2	A	T	2: 71,233,650	T113S	probably benign	Het
Edem2	T	C	2: 155,716,155	E186G	probably damaging	Het
Eya2	G	A	2: 165,763,816	R380H	probably damaging	Het
Fam214a	A	T	9: 75,010,390	D757V	probably damaging	Het
Fam60a	C	T	6: 148,944,880		probably benign	Het
Gldn	A	G	9: 54,312,922	T132A	probably damaging	Het
Gm13941	A	T	2: 111,100,606	I74K	unknown	Het
Gm3898	C	T	9: 43,830,042		noncoding transcript	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Klhdc10	C	T	6: 30,439,865	L127F	possibly damaging	Het
Letm1	G	A	5: 33,769,386	T189M	possibly damaging	Het
Lrrc17	A	T	5: 21,570,357	I306F	possibly damaging	Het
Lrrk2	T	A	15: 91,787,016	V2000E	probably damaging	Het
Mettl9	A	T	7: 121,047,870	E66D	probably benign	Het
Mroh1	T	A	15: 76,433,931	V877D	probably benign	Het
Mycbp2	C	T	14: 103,142,767	V3760M	possibly damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Obp2a	A	T	2: 25,700,830	T70S	possibly damaging	Het
Olfr1040	T	C	2: 86,146,191	D181G	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr1245	C	T	2: 89,574,977	V250I	possibly damaging	Het
Olfr145	A	T	9: 37,897,581	Y59F	probably damaging	Het
Olfr69	T	G	7: 103,768,116	I94L	possibly damaging	Het
Pate2	A	G	9: 35,686,115		probably benign	Het
Pdzph1	A	G	17: 58,973,947	F447L	probably benign	Het
Pias1	A	G	9: 62,920,493	C211R	probably damaging	Het
Plb1	A	G	5: 32,329,947	S929G	probably benign	Het
Prc1	G	A	7: 80,294,542		probably benign	Het
Prex2	A	G	1: 11,140,058	D574G	probably damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rock2	T	C	12: 16,961,641	M690T	possibly damaging	Het
Slc18a2	A	G	19: 59,261,405	I25V	probably benign	Het
Slc9a5	T	A	8: 105,364,691	I701K	probably benign	Het
Sorcs1	T	A	19: 50,222,133	N765Y	probably damaging	Het
Ssh2	A	T	11: 77,450,115	I698L	probably benign	Het
Stam	A	G	2: 14,115,864	D58G	probably damaging	Het
Thsd4	C	A	9: 59,972,400	R1018L	probably damaging	Het
Tnxb	A	G	17: 34,711,024	T2911A	probably benign	Het
Trpm7	A	C	2: 126,813,030	F1329L	probably benign	Het
Ttll9	A	G	2: 152,984,248	E126G	possibly damaging	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Unc45a	G	A	7: 80,334,856	A232V	probably damaging	Het
Utp14b	G	A	1: 78,666,409	V675M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,891	H279L	probably benign	Het
Vmn2r75	G	T	7: 86,166,302	A118E	probably benign	Het
Wdr36	A	T	18: 32,865,959	Q886L	probably damaging	Het
Zfp433	T	A	10: 81,719,291	Y27*	probably null	Het
Zfp715	A	T	7: 43,311,039	S43T	possibly damaging	Het
Zfyve26	A	G	12: 79,239,924	S2297P	possibly damaging	Het

Other mutations in Nos3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00903:Nos3	APN	5	24369862	missense	probably damaging	1.00
IGL02059:Nos3	APN	5	24368998	missense	probably damaging	1.00
IGL02354:Nos3	APN	5	24367623	missense	probably damaging	1.00
IGL02361:Nos3	APN	5	24367623	missense	probably damaging	1.00
IGL02936:Nos3	APN	5	24380993	missense	probably damaging	0.97
IGL03190:Nos3	APN	5	24383629	missense	probably damaging	1.00
paul	UTSW	5	24372704	missense	probably damaging	1.00
Peter	UTSW	5	24377855	missense	probably damaging	0.99
R0111:Nos3	UTSW	5	24372704	missense	probably damaging	1.00
R0387:Nos3	UTSW	5	24367585	missense	probably damaging	1.00
R0755:Nos3	UTSW	5	24367297	missense	probably damaging	1.00
R1156:Nos3	UTSW	5	24377619	missense	probably benign	0.21
R1597:Nos3	UTSW	5	24368997	missense	probably damaging	1.00
R1671:Nos3	UTSW	5	24383840	missense	probably damaging	1.00
R1743:Nos3	UTSW	5	24377312	missense	probably benign	0.22
R1830:Nos3	UTSW	5	24370133	missense	probably damaging	1.00
R1882:Nos3	UTSW	5	24368820	missense	probably damaging	1.00
R2294:Nos3	UTSW	5	24364857	missense	probably damaging	0.99
R3114:Nos3	UTSW	5	24372631	splice site	probably benign
R3978:Nos3	UTSW	5	24377931	missense	probably damaging	1.00
R3980:Nos3	UTSW	5	24377931	missense	probably damaging	1.00
R4016:Nos3	UTSW	5	24371716	missense	probably damaging	1.00
R4905:Nos3	UTSW	5	24367331	missense	probably benign	0.01
R4947:Nos3	UTSW	5	24377855	missense	probably damaging	0.99
R5017:Nos3	UTSW	5	24366719	intron	probably benign
R5095:Nos3	UTSW	5	24368918	splice site	probably benign
R5096:Nos3	UTSW	5	24371957	missense	probably damaging	1.00
R5102:Nos3	UTSW	5	24371627	missense	probably damaging	1.00
R5311:Nos3	UTSW	5	24377345	missense	probably benign	0.19
R5330:Nos3	UTSW	5	24369904	missense	probably damaging	1.00
R5367:Nos3	UTSW	5	24371944	missense	probably benign	0.00
R5394:Nos3	UTSW	5	24383890	missense	probably benign	0.00
R5889:Nos3	UTSW	5	24368777	intron	probably benign
R6032:Nos3	UTSW	5	24379811	missense	probably benign
R6032:Nos3	UTSW	5	24379811	missense	probably benign
R6401:Nos3	UTSW	5	24379811	missense	probably benign
R6517:Nos3	UTSW	5	24383624	missense	probably damaging	1.00
R6888:Nos3	UTSW	5	24383335	missense	possibly damaging	0.86
R6972:Nos3	UTSW	5	24380243	missense	probably benign
R6973:Nos3	UTSW	5	24380243	missense	probably benign
R7432:Nos3	UTSW	5	24367615	missense	probably damaging	0.98
R7434:Nos3	UTSW	5	24382635	missense	probably damaging	0.99
R7507:Nos3	UTSW	5	24372644	missense	probably damaging	1.00
R7553:Nos3	UTSW	5	24381717	missense	possibly damaging	0.62
R7652:Nos3	UTSW	5	24383612	missense	probably damaging	1.00
R8094:Nos3	UTSW	5	24367220	missense	probably benign	0.13
R8686:Nos3	UTSW	5	24368843	missense	possibly damaging	0.83
R8794:Nos3	UTSW	5	24371747	missense	probably damaging	1.00
R9016:Nos3	UTSW	5	24383641	missense	probably damaging	1.00
R9192:Nos3	UTSW	5	24377613	missense	probably benign	0.04
R9336:Nos3	UTSW	5	24379763	missense	probably benign
X0020:Nos3	UTSW	5	24370124	missense	probably damaging	1.00
X0061:Nos3	UTSW	5	24382635	missense	probably damaging	0.99
Z1176:Nos3	UTSW	5	24377654	missense	probably benign	0.02
Z1177:Nos3	UTSW	5	24383950	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTCACATGGACAGTGGGTAG -3'
(R):5'- AGCCATCCTGCTGCCTATAG -3'

Sequencing Primer
(F):5'- ATGGACAGTGGGTAGCTCCTC -3'
(R):5'- CTGTTCCAGATCCGGAAGTC -3'

Posted On

2016-10-26