Mutagenetix > Incidental Mutation

Incidental Mutation 'R0046:Pik3c2a'

43710

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

038340-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116354072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1196 (I1196N)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170430
AA Change: I1196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: I1196N

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000206219
AA Change: I1196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000206385
AA Change: I359N

Meta Mutation Damage Score

0.9548

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	T	4: 56,743,877	K135*	probably null	Het
Adamts16	A	G	13: 70,763,460	S871P	probably benign	Het
Adcy10	A	T	1: 165,539,834	I558F	probably damaging	Het
Adsl	T	G	15: 80,962,788		probably null	Het
Aldob	T	C	4: 49,543,842	I47V	possibly damaging	Het
Alkbh8	A	G	9: 3,343,247	E46G	probably damaging	Het
Ankrd33b	G	A	15: 31,367,337	P19L	probably damaging	Het
Apoa5	T	C	9: 46,269,998	L124S	probably damaging	Het
Atp1a4	A	T	1: 172,240,097	L533Q	probably benign	Het
Atp7b	T	C	8: 22,059,995	T9A	probably benign	Het
Auh	G	A	13: 52,929,385		probably benign	Het
B3gnt3	T	C	8: 71,692,923	Y267C	probably damaging	Het
BC051142	T	C	17: 34,460,121		probably null	Het
Card11	T	C	5: 140,908,524	T117A	possibly damaging	Het
Ccdc39	A	G	3: 33,844,152	F15L	possibly damaging	Het
Chtf18	C	T	17: 25,723,460	R468Q	probably benign	Het
Cntnap5c	T	G	17: 58,359,300	D1108E	probably benign	Het
Col14a1	G	A	15: 55,408,963		probably benign	Het
Col6a6	C	T	9: 105,748,848		probably benign	Het
Col9a3	G	A	2: 180,609,487	A317T	possibly damaging	Het
Cpt1c	A	T	7: 44,959,832		probably benign	Het
Cpt2	A	G	4: 107,904,362		probably null	Het
Crebrf	T	A	17: 26,763,334	L565M	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,782,035		noncoding transcript	Het
Dhx9	C	T	1: 153,472,707	V291M	probably benign	Het
Dmxl1	T	A	18: 49,878,082	V1102E	probably benign	Het
Dnah7a	A	T	1: 53,456,874		probably null	Het
Dock4	G	A	12: 40,737,360		probably benign	Het
Dpp3	G	T	19: 4,914,643	N545K	probably damaging	Het
Elmo2	T	A	2: 165,298,726	N275I	probably damaging	Het
Farp1	A	G	14: 121,255,513	K509R	probably benign	Het
Fat3	T	C	9: 15,965,979	Y3446C	possibly damaging	Het
Fgd2	T	A	17: 29,374,990		probably benign	Het
Flg	T	A	3: 93,277,721		probably benign	Het
Gas2l2	A	T	11: 83,421,910	W859R	probably damaging	Het
Gatm	T	C	2: 122,600,744	D254G	probably damaging	Het
Gjd4	T	A	18: 9,280,998	I27F	probably damaging	Het
Gsdmc2	C	A	15: 63,827,755		probably benign	Het
Haus5	C	T	7: 30,654,180	V591I	probably benign	Het
Kcnab3	G	A	11: 69,330,227		probably null	Het
Khdrbs2	A	G	1: 32,619,202	D281G	possibly damaging	Het
Krt86	A	T	15: 101,477,402	M393L	probably benign	Het
Limk1	T	C	5: 134,672,761	Y96C	probably damaging	Het
Lrp2bp	T	A	8: 46,013,155	Y100*	probably null	Het
Mamstr	T	G	7: 45,641,770		probably benign	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Marf1	G	A	16: 14,111,727	P1672S	possibly damaging	Het
Mboat7	T	C	7: 3,683,818	Y341C	probably damaging	Het
Nhsl1	A	T	10: 18,525,669	N881I	probably damaging	Het
Nox3	T	C	17: 3,682,961	Y225C	probably benign	Het
Nrp1	C	T	8: 128,500,608		probably benign	Het
Olfr1080	A	G	2: 86,553,632	F164S	probably damaging	Het
Olfr1214	C	T	2: 88,987,349	M284I	probably benign	Het
Olfr1260	C	T	2: 89,978,507	T243I	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr742	T	A	14: 50,516,139	*312K	probably null	Het
Pcdhb13	A	T	18: 37,444,257	M563L	probably benign	Het
Pclo	C	T	5: 14,540,479	T931M	unknown	Het
Peli2	C	T	14: 48,121,202	P16S	possibly damaging	Het
Pfas	G	T	11: 68,990,467	R1025S	probably benign	Het
Pmfbp1	A	T	8: 109,535,985		probably benign	Het
Prg4	T	C	1: 150,456,086	T279A	possibly damaging	Het
Psma1	A	T	7: 114,267,205		probably benign	Het
Rab11fip1	A	G	8: 27,153,121	L550P	probably damaging	Het
Rgs12	T	A	5: 34,965,320	I149N	probably damaging	Het
Rmnd5a	T	C	6: 71,399,231	H195R	probably damaging	Het
Rnf17	T	C	14: 56,471,373	L750P	probably damaging	Het
Rtcb	T	C	10: 85,957,656	N18D	probably benign	Het
Seh1l	T	C	18: 67,792,016		probably null	Het
Sis	T	G	3: 72,932,094	N813T	probably benign	Het
Sptbn2	T	C	19: 4,745,377		probably benign	Het
Stag3	C	T	5: 138,283,023		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Taok3	C	T	5: 117,272,229	Q829*	probably null	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttn	A	G	2: 76,951,542		probably benign	Het
Unc79	A	G	12: 103,125,681	E1756G	probably damaging	Het
Usp35	A	T	7: 97,313,597		probably null	Het
Vmn2r111	A	G	17: 22,548,009	F836L	probably benign	Het
Vmn2r77	A	G	7: 86,801,938	D344G	possibly damaging	Het
Zbtb40	A	G	4: 136,987,278	C1067R	probably damaging	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	116346247	splice site	probably benign
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	116388065	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116418520	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7153:Pik3c2a	UTSW	7	116342252	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	116388096	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	116346192	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACAGGTCAACAGATAGATAGCACTTC -3'
(R):5'- gccatctctccagATCTTGGATGCTTT -3'

Sequencing Primer
(F):5'- TGACATTGAACCTGGAGTCC -3'
(R):5'- ctgtaacgaaatctgatgccc -3'

Posted On

2013-05-29