Incidental Mutation 'R5574:Cyp2g1'
ID 437103
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Name cytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
MMRRC Submission 043129-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26508352-26520622 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26520165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 466 (V466M)
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
AlphaFold Q9WV19
Predicted Effect possibly damaging
Transcript: ENSMUST00000040944
AA Change: V466M

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685
AA Change: V466M

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205273
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,380,205 (GRCm39) N31I possibly damaging Het
Acvr1b T A 15: 101,099,958 (GRCm39) M304K probably benign Het
Adamts1 G T 16: 85,596,530 (GRCm39) D106E probably damaging Het
Atosa A T 9: 74,917,672 (GRCm39) D757V probably damaging Het
Blm C A 7: 80,149,521 (GRCm39) C696F probably damaging Het
Bnip3l-ps T A 12: 18,267,119 (GRCm39) noncoding transcript Het
Ccdc171 A T 4: 83,611,990 (GRCm39) N895I probably damaging Het
Cdhr4 A T 9: 107,870,527 (GRCm39) probably benign Het
Cfap97 T C 8: 46,623,179 (GRCm39) S190P probably damaging Het
Chrnb1 A C 11: 69,684,509 (GRCm39) probably benign Het
Clns1a A G 7: 97,370,165 (GRCm39) probably benign Het
Col8a2 G A 4: 126,205,061 (GRCm39) probably benign Het
Cr2 T A 1: 194,823,544 (GRCm39) E721V probably damaging Het
Csk A G 9: 57,536,584 (GRCm39) V172A probably benign Het
Cyp4f13 A G 17: 33,148,179 (GRCm39) Y349H probably benign Het
Dnm1l T C 16: 16,147,685 (GRCm39) Y205C probably damaging Het
Dync1i2 A T 2: 71,063,994 (GRCm39) T113S probably benign Het
Edem2 T C 2: 155,558,075 (GRCm39) E186G probably damaging Het
Eya2 G A 2: 165,605,736 (GRCm39) R380H probably damaging Het
Gldn A G 9: 54,220,206 (GRCm39) T132A probably damaging Het
Gm13941 A T 2: 110,930,951 (GRCm39) I74K unknown Het
Gm3898 C T 9: 43,741,339 (GRCm39) noncoding transcript Het
Ighmbp2 C T 19: 3,321,536 (GRCm39) V408I probably benign Het
Klhdc10 C T 6: 30,439,864 (GRCm39) L127F possibly damaging Het
Letm1 G A 5: 33,926,730 (GRCm39) T189M possibly damaging Het
Lrrc17 A T 5: 21,775,355 (GRCm39) I306F possibly damaging Het
Lrrk2 T A 15: 91,671,219 (GRCm39) V2000E probably damaging Het
Mettl9 A T 7: 120,647,093 (GRCm39) E66D probably benign Het
Mroh1 T A 15: 76,318,131 (GRCm39) V877D probably benign Het
Mycbp2 C T 14: 103,380,203 (GRCm39) V3760M possibly damaging Het
Nos3 A G 5: 24,573,859 (GRCm39) T208A possibly damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Obp2a A T 2: 25,590,842 (GRCm39) T70S possibly damaging Het
Or4a72 C T 2: 89,405,321 (GRCm39) V250I possibly damaging Het
Or52a5b T G 7: 103,417,323 (GRCm39) I94L possibly damaging Het
Or5al6 T C 2: 85,976,535 (GRCm39) D181G probably damaging Het
Or8b8 A T 9: 37,808,877 (GRCm39) Y59F probably damaging Het
Or8h10 A G 2: 86,808,867 (GRCm39) V91A probably benign Het
Pate2 A G 9: 35,597,411 (GRCm39) probably benign Het
Pdzph1 A G 17: 59,280,942 (GRCm39) F447L probably benign Het
Pias1 A G 9: 62,827,775 (GRCm39) C211R probably damaging Het
Plb1 A G 5: 32,487,291 (GRCm39) S929G probably benign Het
Pramel32 T G 4: 88,546,280 (GRCm39) E354A probably benign Het
Prc1 G A 7: 79,944,290 (GRCm39) probably benign Het
Prex2 A G 1: 11,210,282 (GRCm39) D574G probably damaging Het
Rapgef4 G A 2: 71,864,464 (GRCm39) probably null Het
Rmc1 CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,318,063 (GRCm39) probably null Het
Rock2 T C 12: 17,011,642 (GRCm39) M690T possibly damaging Het
Sinhcaf C T 6: 148,846,378 (GRCm39) probably benign Het
Slc18a2 A G 19: 59,249,837 (GRCm39) I25V probably benign Het
Slc9a5 T A 8: 106,091,323 (GRCm39) I701K probably benign Het
Sorcs1 T A 19: 50,210,571 (GRCm39) N765Y probably damaging Het
Ssh2 A T 11: 77,340,941 (GRCm39) I698L probably benign Het
Stam A G 2: 14,120,675 (GRCm39) D58G probably damaging Het
Thsd4 C A 9: 59,879,683 (GRCm39) R1018L probably damaging Het
Tnxb A G 17: 34,929,998 (GRCm39) T2911A probably benign Het
Trpm7 A C 2: 126,654,950 (GRCm39) F1329L probably benign Het
Ttll9 A G 2: 152,826,168 (GRCm39) E126G possibly damaging Het
Tubgcp5 G A 7: 55,455,077 (GRCm39) V258M probably benign Het
Unc45a G A 7: 79,984,604 (GRCm39) A232V probably damaging Het
Utp14b G A 1: 78,644,126 (GRCm39) V675M probably damaging Het
Vmn2r67 T A 7: 84,801,099 (GRCm39) H279L probably benign Het
Vmn2r75 G T 7: 85,815,510 (GRCm39) A118E probably benign Het
Wdr36 A T 18: 32,999,012 (GRCm39) Q886L probably damaging Het
Zfp433 T A 10: 81,555,125 (GRCm39) Y27* probably null Het
Zfp715 A T 7: 42,960,463 (GRCm39) S43T possibly damaging Het
Zfyve26 A G 12: 79,286,698 (GRCm39) S2297P possibly damaging Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26,509,256 (GRCm39) missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26,513,684 (GRCm39) missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26,513,719 (GRCm39) splice site probably benign
IGL02338:Cyp2g1 APN 7 26,514,229 (GRCm39) splice site probably benign
IGL02452:Cyp2g1 APN 7 26,510,871 (GRCm39) missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26,518,612 (GRCm39) missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26,509,201 (GRCm39) missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26,518,828 (GRCm39) missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26,513,619 (GRCm39) missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26,513,720 (GRCm39) splice site probably benign
R0697:Cyp2g1 UTSW 7 26,514,152 (GRCm39) nonsense probably null
R0830:Cyp2g1 UTSW 7 26,514,216 (GRCm39) missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26,509,107 (GRCm39) critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26,518,858 (GRCm39) missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26,520,135 (GRCm39) missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26,513,579 (GRCm39) missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26,520,226 (GRCm39) missense probably benign 0.06
R5877:Cyp2g1 UTSW 7 26,516,065 (GRCm39) missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26,513,604 (GRCm39) missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26,520,184 (GRCm39) missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26,514,057 (GRCm39) missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26,518,618 (GRCm39) missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26,518,886 (GRCm39) missense probably benign
R8177:Cyp2g1 UTSW 7 26,518,578 (GRCm39) missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26,514,159 (GRCm39) missense possibly damaging 0.89
R9043:Cyp2g1 UTSW 7 26,509,256 (GRCm39) missense probably benign 0.05
R9406:Cyp2g1 UTSW 7 26,518,910 (GRCm39) critical splice donor site probably null
R9441:Cyp2g1 UTSW 7 26,514,060 (GRCm39) missense possibly damaging 0.72
X0067:Cyp2g1 UTSW 7 26,520,187 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ATAATCAGTCGAGGCTGCGTG -3'
(R):5'- AGACACCTCTCTTGACCCATG -3'

Sequencing Primer
(F):5'- GGGGTGGTTATGGTAGGGACATG -3'
(R):5'- ACCTCTCTTCAAGGAGTATGGAG -3'
Posted On 2016-10-26