Incidental Mutation 'R5574:Cyp2g1'
ID437103
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Namecytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5574 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26808892-26821205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26820740 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 466 (V466M)
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040944
AA Change: V466M

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685
AA Change: V466M

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205273
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26809831 missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26814259 missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26814294 splice site probably benign
IGL02338:Cyp2g1 APN 7 26814804 splice site probably benign
IGL02452:Cyp2g1 APN 7 26811446 missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26819187 missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26809776 missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26819403 missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26814194 missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26814295 splice site probably benign
R0697:Cyp2g1 UTSW 7 26814727 nonsense probably null
R0830:Cyp2g1 UTSW 7 26814791 missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26809682 critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26819433 missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26820710 missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26814154 missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26820801 missense probably benign 0.06
R5877:Cyp2g1 UTSW 7 26816640 missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26814179 missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26820759 missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26814632 missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26819193 missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26819461 missense probably benign
R8177:Cyp2g1 UTSW 7 26819153 missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26814734 missense possibly damaging 0.89
X0067:Cyp2g1 UTSW 7 26820762 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ATAATCAGTCGAGGCTGCGTG -3'
(R):5'- AGACACCTCTCTTGACCCATG -3'

Sequencing Primer
(F):5'- GGGGTGGTTATGGTAGGGACATG -3'
(R):5'- ACCTCTCTTCAAGGAGTATGGAG -3'
Posted On2016-10-26