Incidental Mutation 'R5574:Vmn2r67'
ID437109
Institutional Source Beutler Lab
Gene Symbol Vmn2r67
Ensembl Gene ENSMUSG00000095664
Gene Namevomeronasal 2, receptor 67
SynonymsEG620672
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5574 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85136240-85155902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85151891 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 279 (H279L)
Ref Sequence ENSEMBL: ENSMUSP00000126007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168730]
Predicted Effect probably benign
Transcript: ENSMUST00000168730
AA Change: H279L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664
AA Change: H279L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 464 2.1e-31 PFAM
Pfam:NCD3G 507 559 4.8e-19 PFAM
Pfam:7tm_3 590 827 1.4e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Vmn2r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Vmn2r67 APN 7 85151930 missense probably damaging 1.00
IGL01346:Vmn2r67 APN 7 85136919 missense probably damaging 1.00
IGL01373:Vmn2r67 APN 7 85136626 missense probably benign 0.10
IGL01674:Vmn2r67 APN 7 85136443 missense probably damaging 1.00
IGL01978:Vmn2r67 APN 7 85151441 critical splice donor site probably null
IGL02013:Vmn2r67 APN 7 85151655 missense probably benign 0.09
IGL02115:Vmn2r67 APN 7 85151579 missense probably damaging 0.99
IGL02250:Vmn2r67 APN 7 85155800 missense probably benign
IGL02252:Vmn2r67 APN 7 85155800 missense probably benign
IGL02328:Vmn2r67 APN 7 85150690 missense probably benign 0.41
IGL02740:Vmn2r67 APN 7 85136610 missense probably damaging 1.00
IGL02940:Vmn2r67 APN 7 85136743 missense probably benign 0.07
IGL03237:Vmn2r67 APN 7 85149910 missense probably damaging 1.00
R0512:Vmn2r67 UTSW 7 85150692 missense probably damaging 1.00
R1029:Vmn2r67 UTSW 7 85136766 missense probably damaging 1.00
R1193:Vmn2r67 UTSW 7 85151445 missense probably damaging 0.98
R1282:Vmn2r67 UTSW 7 85136724 missense probably benign
R1416:Vmn2r67 UTSW 7 85151616 missense probably benign 0.06
R1429:Vmn2r67 UTSW 7 85152823 missense possibly damaging 0.65
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1970:Vmn2r67 UTSW 7 85151805 missense probably benign
R2229:Vmn2r67 UTSW 7 85152042 missense probably benign 0.21
R2246:Vmn2r67 UTSW 7 85136556 missense probably damaging 1.00
R2262:Vmn2r67 UTSW 7 85136974 missense probably damaging 0.96
R2398:Vmn2r67 UTSW 7 85136713 missense probably damaging 1.00
R4249:Vmn2r67 UTSW 7 85150514 splice site probably null
R4666:Vmn2r67 UTSW 7 85150623 missense probably benign
R4669:Vmn2r67 UTSW 7 85150524 missense probably benign 0.11
R4966:Vmn2r67 UTSW 7 85136385 missense probably damaging 1.00
R5264:Vmn2r67 UTSW 7 85152245 missense probably damaging 1.00
R5296:Vmn2r67 UTSW 7 85137022 missense probably damaging 1.00
R5327:Vmn2r67 UTSW 7 85136490 missense probably damaging 1.00
R5401:Vmn2r67 UTSW 7 85136557 missense probably damaging 1.00
R5510:Vmn2r67 UTSW 7 85151815 missense probably benign 0.39
R5643:Vmn2r67 UTSW 7 85149943 nonsense probably null
R5914:Vmn2r67 UTSW 7 85151836 missense probably damaging 1.00
R6248:Vmn2r67 UTSW 7 85150560 missense probably damaging 0.99
R6291:Vmn2r67 UTSW 7 85149934 missense possibly damaging 0.88
R6309:Vmn2r67 UTSW 7 85151916 missense probably benign
R6442:Vmn2r67 UTSW 7 85155838 missense possibly damaging 0.82
R6665:Vmn2r67 UTSW 7 85136692 missense probably benign 0.07
R6701:Vmn2r67 UTSW 7 85152815 missense probably damaging 1.00
R6848:Vmn2r67 UTSW 7 85152632 missense probably benign 0.00
R6852:Vmn2r67 UTSW 7 85152153 missense probably damaging 0.99
R6991:Vmn2r67 UTSW 7 85155745 missense possibly damaging 0.55
R7143:Vmn2r67 UTSW 7 85152638 missense probably benign
R7197:Vmn2r67 UTSW 7 85136566 missense possibly damaging 0.77
R7393:Vmn2r67 UTSW 7 85155878 missense probably null 0.87
R7420:Vmn2r67 UTSW 7 85136736 missense possibly damaging 0.52
R7622:Vmn2r67 UTSW 7 85136454 missense probably damaging 1.00
R7664:Vmn2r67 UTSW 7 85155811 missense probably benign 0.21
R7665:Vmn2r67 UTSW 7 85151988 nonsense probably null
R7896:Vmn2r67 UTSW 7 85136712 missense probably damaging 1.00
R7913:Vmn2r67 UTSW 7 85151828 missense possibly damaging 0.87
R8026:Vmn2r67 UTSW 7 85136716 missense probably damaging 1.00
R8114:Vmn2r67 UTSW 7 85155889 missense probably benign 0.01
R8317:Vmn2r67 UTSW 7 85136626 missense probably benign 0.10
R8363:Vmn2r67 UTSW 7 85155761 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTACTGTAATTTGAAGGGTGTACTG -3'
(R):5'- AGCGATTGTTACAACTGATGACC -3'

Sequencing Primer
(F):5'- AAGGGTGTACTGTTTGGATAAATTG -3'
(R):5'- CCTTTCTGAATTGAGAGGAGAAATGC -3'
Posted On2016-10-26