Incidental Mutation 'R0046:Atp7b'
ID 43711
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene Name ATPase, Cu++ transporting, beta polypeptide
Synonyms Atp7a, WND, Wilson protein
MMRRC Submission 038340-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.602) question?
Stock # R0046 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 22482801-22550321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22550011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 9 (T9A)
Ref Sequence ENSEMBL: ENSMUSP00000106366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000072572] [ENSMUST00000110737] [ENSMUST00000110738]
AlphaFold Q64446
Predicted Effect probably benign
Transcript: ENSMUST00000006742
AA Change: T21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: T21A

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072572
SMART Domains Protein: ENSMUSP00000072382
Gene: ENSMUSG00000063362

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:ALG11_N 62 269 2.6e-94 PFAM
Pfam:Glycos_transf_1 293 470 1.4e-30 PFAM
Pfam:Glyco_trans_1_4 301 454 8.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110737
SMART Domains Protein: ENSMUSP00000106365
Gene: ENSMUSG00000063362

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
Pfam:Glycos_transf_1 248 428 3.8e-29 PFAM
Pfam:Glyco_trans_1_4 259 412 7.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110738
AA Change: T9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: T9A

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131624
SMART Domains Protein: ENSMUSP00000119161
Gene: ENSMUSG00000063362

DomainStartEndE-ValueType
Pfam:ALG11_N 4 160 1.4e-60 PFAM
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 (GRCm39) K135* probably null Het
Adamts16 A G 13: 70,911,579 (GRCm39) S871P probably benign Het
Adcy10 A T 1: 165,367,403 (GRCm39) I558F probably damaging Het
Adsl T G 15: 80,846,989 (GRCm39) probably null Het
Aldob T C 4: 49,543,842 (GRCm39) I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 (GRCm39) E46G probably damaging Het
Ankrd33b G A 15: 31,367,483 (GRCm39) P19L probably damaging Het
Apoa5 T C 9: 46,181,296 (GRCm39) L124S probably damaging Het
Atp1a4 A T 1: 172,067,664 (GRCm39) L533Q probably benign Het
Auh G A 13: 53,083,421 (GRCm39) probably benign Het
B3gnt3 T C 8: 72,145,567 (GRCm39) Y267C probably damaging Het
Card11 T C 5: 140,894,279 (GRCm39) T117A possibly damaging Het
Ccdc39 A G 3: 33,898,301 (GRCm39) F15L possibly damaging Het
Chtf18 C T 17: 25,942,434 (GRCm39) R468Q probably benign Het
Cntnap5c T G 17: 58,666,295 (GRCm39) D1108E probably benign Het
Col14a1 G A 15: 55,272,359 (GRCm39) probably benign Het
Col6a6 C T 9: 105,626,047 (GRCm39) probably benign Het
Col9a3 G A 2: 180,251,280 (GRCm39) A317T possibly damaging Het
Cpt1c A T 7: 44,609,256 (GRCm39) probably benign Het
Cpt2 A G 4: 107,761,559 (GRCm39) probably null Het
Crebrf T A 17: 26,982,308 (GRCm39) L565M probably damaging Het
Cyp2d41-ps T A 15: 82,666,236 (GRCm39) noncoding transcript Het
Dhx9 C T 1: 153,348,453 (GRCm39) V291M probably benign Het
Dmxl1 T A 18: 50,011,149 (GRCm39) V1102E probably benign Het
Dnah7a A T 1: 53,496,033 (GRCm39) probably null Het
Dock4 G A 12: 40,787,359 (GRCm39) probably benign Het
Dpp3 G T 19: 4,964,671 (GRCm39) N545K probably damaging Het
Elmo2 T A 2: 165,140,646 (GRCm39) N275I probably damaging Het
Farp1 A G 14: 121,492,925 (GRCm39) K509R probably benign Het
Fat3 T C 9: 15,877,275 (GRCm39) Y3446C possibly damaging Het
Fgd2 T A 17: 29,593,964 (GRCm39) probably benign Het
Flg T A 3: 93,185,028 (GRCm39) probably benign Het
Gas2l2 A T 11: 83,312,736 (GRCm39) W859R probably damaging Het
Gatm T C 2: 122,431,225 (GRCm39) D254G probably damaging Het
Gjd4 T A 18: 9,280,998 (GRCm39) I27F probably damaging Het
Gsdmc2 C A 15: 63,699,604 (GRCm39) probably benign Het
Haus5 C T 7: 30,353,605 (GRCm39) V591I probably benign Het
Kcnab3 G A 11: 69,221,053 (GRCm39) probably null Het
Khdrbs2 A G 1: 32,658,283 (GRCm39) D281G possibly damaging Het
Krt86 A T 15: 101,375,283 (GRCm39) M393L probably benign Het
Limk1 T C 5: 134,701,615 (GRCm39) Y96C probably damaging Het
Lrp2bp T A 8: 46,466,192 (GRCm39) Y100* probably null Het
Mamstr T G 7: 45,291,194 (GRCm39) probably benign Het
Man1a A G 10: 53,795,283 (GRCm39) Y657H probably damaging Het
Marf1 G A 16: 13,929,591 (GRCm39) P1672S possibly damaging Het
Mboat7 T C 7: 3,686,817 (GRCm39) Y341C probably damaging Het
Nhsl1 A T 10: 18,401,417 (GRCm39) N881I probably damaging Het
Nox3 T C 17: 3,733,236 (GRCm39) Y225C probably benign Het
Nrp1 C T 8: 129,227,089 (GRCm39) probably benign Het
Or11g26 T A 14: 50,753,596 (GRCm39) *312K probably null Het
Or4c109 C T 2: 88,817,693 (GRCm39) M284I probably benign Het
Or4c35 C T 2: 89,808,851 (GRCm39) T243I probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or8k33 A G 2: 86,383,976 (GRCm39) F164S probably damaging Het
Pcdhb13 A T 18: 37,577,310 (GRCm39) M563L probably benign Het
Pclo C T 5: 14,590,493 (GRCm39) T931M unknown Het
Peli2 C T 14: 48,358,659 (GRCm39) P16S possibly damaging Het
Pfas G T 11: 68,881,293 (GRCm39) R1025S probably benign Het
Pik3c2a A T 7: 115,953,307 (GRCm39) I1196N probably damaging Het
Pmfbp1 A T 8: 110,262,617 (GRCm39) probably benign Het
Prg4 T C 1: 150,331,837 (GRCm39) T279A possibly damaging Het
Psma1 A T 7: 113,866,440 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,643,149 (GRCm39) L550P probably damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Rmnd5a T C 6: 71,376,215 (GRCm39) H195R probably damaging Het
Rnf17 T C 14: 56,708,830 (GRCm39) L750P probably damaging Het
Rtcb T C 10: 85,793,520 (GRCm39) N18D probably benign Het
Seh1l T C 18: 67,925,086 (GRCm39) probably null Het
Sis T G 3: 72,839,427 (GRCm39) N813T probably benign Het
Sptbn2 T C 19: 4,795,405 (GRCm39) probably benign Het
Stag3 C T 5: 138,281,285 (GRCm39) probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Taok3 C T 5: 117,410,294 (GRCm39) Q829* probably null Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tsbp1 T C 17: 34,679,095 (GRCm39) probably null Het
Ttn A G 2: 76,781,886 (GRCm39) probably benign Het
Unc79 A G 12: 103,091,940 (GRCm39) E1756G probably damaging Het
Usp35 A T 7: 96,962,804 (GRCm39) probably null Het
Vmn2r111 A G 17: 22,766,990 (GRCm39) F836L probably benign Het
Vmn2r77 A G 7: 86,451,146 (GRCm39) D344G possibly damaging Het
Zbtb40 A G 4: 136,714,589 (GRCm39) C1067R probably damaging Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22,501,114 (GRCm39) missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22,517,543 (GRCm39) splice site probably null
IGL01600:Atp7b APN 8 22,517,541 (GRCm39) splice site probably null
IGL01713:Atp7b APN 8 22,518,589 (GRCm39) missense probably damaging 1.00
IGL01778:Atp7b APN 8 22,484,844 (GRCm39) missense probably benign 0.42
IGL01926:Atp7b APN 8 22,501,797 (GRCm39) missense probably damaging 0.98
IGL02312:Atp7b APN 8 22,484,786 (GRCm39) missense probably damaging 0.99
IGL02562:Atp7b APN 8 22,518,101 (GRCm39) missense probably benign
IGL02573:Atp7b APN 8 22,512,486 (GRCm39) missense probably benign 0.00
IGL02603:Atp7b APN 8 22,484,792 (GRCm39) missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22,518,454 (GRCm39) missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22,512,493 (GRCm39) missense probably benign 0.00
IGL03145:Atp7b APN 8 22,508,159 (GRCm39) missense probably damaging 1.00
daffodil UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
menace UTSW 8 22,512,381 (GRCm39) missense probably damaging 0.97
PIT4131001:Atp7b UTSW 8 22,484,672 (GRCm39) missense probably damaging 1.00
R0023:Atp7b UTSW 8 22,501,089 (GRCm39) missense probably damaging 1.00
R0128:Atp7b UTSW 8 22,518,188 (GRCm39) missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22,518,188 (GRCm39) missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22,518,467 (GRCm39) missense probably benign 0.22
R0412:Atp7b UTSW 8 22,485,675 (GRCm39) splice site probably null
R0856:Atp7b UTSW 8 22,487,647 (GRCm39) missense probably damaging 1.00
R0906:Atp7b UTSW 8 22,517,842 (GRCm39) missense probably benign
R0989:Atp7b UTSW 8 22,518,710 (GRCm39) missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22,501,801 (GRCm39) missense probably benign 0.17
R1517:Atp7b UTSW 8 22,487,374 (GRCm39) missense probably damaging 1.00
R1521:Atp7b UTSW 8 22,517,689 (GRCm39) missense probably damaging 0.96
R1529:Atp7b UTSW 8 22,518,740 (GRCm39) missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22,501,039 (GRCm39) missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22,496,403 (GRCm39) missense probably damaging 1.00
R1815:Atp7b UTSW 8 22,501,667 (GRCm39) missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22,517,996 (GRCm39) missense probably damaging 1.00
R2133:Atp7b UTSW 8 22,501,093 (GRCm39) missense probably damaging 1.00
R2155:Atp7b UTSW 8 22,503,600 (GRCm39) missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22,504,563 (GRCm39) missense probably damaging 0.99
R2256:Atp7b UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
R2257:Atp7b UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
R2274:Atp7b UTSW 8 22,510,848 (GRCm39) missense probably benign 0.20
R2475:Atp7b UTSW 8 22,484,792 (GRCm39) missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R2907:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R3421:Atp7b UTSW 8 22,518,686 (GRCm39) missense probably damaging 1.00
R3422:Atp7b UTSW 8 22,518,686 (GRCm39) missense probably damaging 1.00
R3688:Atp7b UTSW 8 22,494,246 (GRCm39) missense probably damaging 1.00
R3945:Atp7b UTSW 8 22,510,880 (GRCm39) missense probably benign 0.02
R4235:Atp7b UTSW 8 22,501,039 (GRCm39) missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22,490,137 (GRCm39) missense probably benign 0.00
R4701:Atp7b UTSW 8 22,490,137 (GRCm39) missense probably benign 0.00
R4877:Atp7b UTSW 8 22,518,617 (GRCm39) missense probably damaging 0.98
R4962:Atp7b UTSW 8 22,510,901 (GRCm39) missense probably damaging 1.00
R5009:Atp7b UTSW 8 22,517,714 (GRCm39) missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22,505,885 (GRCm39) splice site probably null
R5038:Atp7b UTSW 8 22,518,472 (GRCm39) missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22,504,570 (GRCm39) missense probably benign
R5467:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R5468:Atp7b UTSW 8 22,549,986 (GRCm39) critical splice donor site probably null
R5512:Atp7b UTSW 8 22,502,755 (GRCm39) missense probably benign 0.20
R5563:Atp7b UTSW 8 22,518,730 (GRCm39) missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22,508,144 (GRCm39) missense probably damaging 1.00
R5773:Atp7b UTSW 8 22,517,879 (GRCm39) missense probably benign
R5941:Atp7b UTSW 8 22,487,512 (GRCm39) missense probably damaging 0.98
R6227:Atp7b UTSW 8 22,510,841 (GRCm39) missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22,505,943 (GRCm39) nonsense probably null
R6290:Atp7b UTSW 8 22,510,836 (GRCm39) missense probably damaging 1.00
R6368:Atp7b UTSW 8 22,510,771 (GRCm39) splice site probably null
R6647:Atp7b UTSW 8 22,518,494 (GRCm39) missense probably damaging 1.00
R6788:Atp7b UTSW 8 22,494,391 (GRCm39) missense probably benign 0.37
R6830:Atp7b UTSW 8 22,512,381 (GRCm39) missense probably damaging 0.97
R6886:Atp7b UTSW 8 22,518,706 (GRCm39) missense probably benign 0.01
R6928:Atp7b UTSW 8 22,484,828 (GRCm39) missense probably benign
R6965:Atp7b UTSW 8 22,518,101 (GRCm39) missense probably benign
R7203:Atp7b UTSW 8 22,487,351 (GRCm39) missense probably damaging 1.00
R7222:Atp7b UTSW 8 22,512,394 (GRCm39) nonsense probably null
R7344:Atp7b UTSW 8 22,487,515 (GRCm39) missense probably damaging 1.00
R7384:Atp7b UTSW 8 22,512,331 (GRCm39) missense probably benign 0.01
R7449:Atp7b UTSW 8 22,501,865 (GRCm39) missense probably damaging 0.98
R7451:Atp7b UTSW 8 22,504,700 (GRCm39) nonsense probably null
R7607:Atp7b UTSW 8 22,501,522 (GRCm39) missense probably damaging 1.00
R8140:Atp7b UTSW 8 22,518,576 (GRCm39) missense probably damaging 1.00
R8160:Atp7b UTSW 8 22,487,575 (GRCm39) missense probably damaging 0.98
R8349:Atp7b UTSW 8 22,503,556 (GRCm39) missense probably damaging 1.00
R8421:Atp7b UTSW 8 22,518,487 (GRCm39) missense probably benign 0.01
R8449:Atp7b UTSW 8 22,503,556 (GRCm39) missense probably damaging 1.00
R8749:Atp7b UTSW 8 22,518,334 (GRCm39) missense probably damaging 0.96
R8989:Atp7b UTSW 8 22,510,911 (GRCm39) missense probably benign 0.06
R9210:Atp7b UTSW 8 22,487,406 (GRCm39) missense probably damaging 1.00
R9353:Atp7b UTSW 8 22,517,890 (GRCm39) missense possibly damaging 0.78
R9462:Atp7b UTSW 8 22,490,160 (GRCm39) missense probably damaging 0.99
R9485:Atp7b UTSW 8 22,502,778 (GRCm39) missense probably damaging 0.99
Z1176:Atp7b UTSW 8 22,518,730 (GRCm39) missense probably benign 0.07
Z1177:Atp7b UTSW 8 22,484,893 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCGAGGTATTAGCACTCCCAGG -3'
(R):5'- TCCAGTACAGAGTCCGCTCTTTCAG -3'

Sequencing Primer
(F):5'- GGCTCGAAATCGTTGTACAC -3'
(R):5'- AGTCCGCTCTTTCAGAGGTG -3'
Posted On 2013-05-29