Mutagenetix > Incidental Mutations

Incidental Mutation 'R5574:Clns1a'

437111

Institutional Source

Beutler Lab

Gene Symbol

Clns1a

Ensembl Gene

ENSMUSG00000025439

Gene Name

chloride channel, nucleotide-sensitive, 1A

Synonyms

Clci, ICLN, Clcni, 2610100O04Rik, 2610036D06Rik

MMRRC Submission

043129-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97696634-97720796 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 97720958 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026506] [ENSMUST00000206389]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026506

SMART Domains

Protein: ENSMUSP00000026506
Gene: ENSMUSG00000025439

Domain	Start	End	E-Value	Type
Pfam:Voldacs	40	168	1.2e-37	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000070021
AA Change: T5A

SMART Domains

Protein: ENSMUSP00000065375
Gene: ENSMUSG00000056106
AA Change: T5A

Domain	Start	End	E-Value	Type
transmembrane domain	98	120	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205667

Predicted Effect

probably benign
Transcript: ENSMUST00000206389

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous mutants die between E3.5-E7.5. Heterozygous mutants appear normal and healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,756	N31I	possibly damaging	Het
3110002H16Rik	CTGTGTGTT	CTGTGTGTTGTGTGTT	18: 12,185,006		probably null	Het
Acvr1b	T	A	15: 101,202,077	M304K	probably benign	Het
Adamts1	G	T	16: 85,799,642	D106E	probably damaging	Het
Blm	C	A	7: 80,499,773	C696F	probably damaging	Het
Bnip3l-ps	T	A	12: 18,217,118		noncoding transcript	Het
C87499	T	G	4: 88,628,043	E354A	probably benign	Het
Ccdc171	A	T	4: 83,693,753	N895I	probably damaging	Het
Cdhr4	A	T	9: 107,993,328		probably benign	Het
Cfap97	T	C	8: 46,170,142	S190P	probably damaging	Het
Chrnb1	A	C	11: 69,793,683		probably benign	Het
Col8a2	G	A	4: 126,311,268		probably benign	Het
Cr2	T	A	1: 195,141,236	E721V	probably damaging	Het
Csk	A	G	9: 57,629,301	V172A	probably benign	Het
Cyp2g1	G	A	7: 26,820,740	V466M	possibly damaging	Het
Cyp4f13	A	G	17: 32,929,205	Y349H	probably benign	Het
Dnm1l	T	C	16: 16,329,821	Y205C	probably damaging	Het
Dync1i2	A	T	2: 71,233,650	T113S	probably benign	Het
Edem2	T	C	2: 155,716,155	E186G	probably damaging	Het
Eya2	G	A	2: 165,763,816	R380H	probably damaging	Het
Fam214a	A	T	9: 75,010,390	D757V	probably damaging	Het
Fam60a	C	T	6: 148,944,880		probably benign	Het
Gldn	A	G	9: 54,312,922	T132A	probably damaging	Het
Gm13941	A	T	2: 111,100,606	I74K	unknown	Het
Gm3898	C	T	9: 43,830,042		noncoding transcript	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Klhdc10	C	T	6: 30,439,865	L127F	possibly damaging	Het
Letm1	G	A	5: 33,769,386	T189M	possibly damaging	Het
Lrrc17	A	T	5: 21,570,357	I306F	possibly damaging	Het
Lrrk2	T	A	15: 91,787,016	V2000E	probably damaging	Het
Mettl9	A	T	7: 121,047,870	E66D	probably benign	Het
Mroh1	T	A	15: 76,433,931	V877D	probably benign	Het
Mycbp2	C	T	14: 103,142,767	V3760M	possibly damaging	Het
Nos3	A	G	5: 24,368,861	T208A	possibly damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Obp2a	A	T	2: 25,700,830	T70S	possibly damaging	Het
Olfr1040	T	C	2: 86,146,191	D181G	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr1245	C	T	2: 89,574,977	V250I	possibly damaging	Het
Olfr145	A	T	9: 37,897,581	Y59F	probably damaging	Het
Olfr69	T	G	7: 103,768,116	I94L	possibly damaging	Het
Pate2	A	G	9: 35,686,115		probably benign	Het
Pdzph1	A	G	17: 58,973,947	F447L	probably benign	Het
Pias1	A	G	9: 62,920,493	C211R	probably damaging	Het
Plb1	A	G	5: 32,329,947	S929G	probably benign	Het
Prc1	G	A	7: 80,294,542		probably benign	Het
Prex2	A	G	1: 11,140,058	D574G	probably damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rock2	T	C	12: 16,961,641	M690T	possibly damaging	Het
Slc18a2	A	G	19: 59,261,405	I25V	probably benign	Het
Slc9a5	T	A	8: 105,364,691	I701K	probably benign	Het
Sorcs1	T	A	19: 50,222,133	N765Y	probably damaging	Het
Ssh2	A	T	11: 77,450,115	I698L	probably benign	Het
Stam	A	G	2: 14,115,864	D58G	probably damaging	Het
Thsd4	C	A	9: 59,972,400	R1018L	probably damaging	Het
Tnxb	A	G	17: 34,711,024	T2911A	probably benign	Het
Trpm7	A	C	2: 126,813,030	F1329L	probably benign	Het
Ttll9	A	G	2: 152,984,248	E126G	possibly damaging	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Unc45a	G	A	7: 80,334,856	A232V	probably damaging	Het
Utp14b	G	A	1: 78,666,409	V675M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,891	H279L	probably benign	Het
Vmn2r75	G	T	7: 86,166,302	A118E	probably benign	Het
Wdr36	A	T	18: 32,865,959	Q886L	probably damaging	Het
Zfp433	T	A	10: 81,719,291	Y27*	probably null	Het
Zfp715	A	T	7: 43,311,039	S43T	possibly damaging	Het
Zfyve26	A	G	12: 79,239,924	S2297P	possibly damaging	Het

Other mutations in Clns1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00808:Clns1a	APN	7	97716514	missense	probably damaging	0.99
IGL03209:Clns1a	APN	7	97711730	missense	probably null	0.05
R0234:Clns1a	UTSW	7	97714032	missense	possibly damaging	0.93
R0234:Clns1a	UTSW	7	97714032	missense	possibly damaging	0.93
R1087:Clns1a	UTSW	7	97705655	missense	possibly damaging	0.63
R1844:Clns1a	UTSW	7	97696859	missense	probably damaging	0.97
R2119:Clns1a	UTSW	7	97713904	splice site	probably null
R3797:Clns1a	UTSW	7	97696835	missense	probably benign	0.00
R4463:Clns1a	UTSW	7	97720949	unclassified	probably benign
R4810:Clns1a	UTSW	7	97714017	missense	probably benign	0.10
R6608:Clns1a	UTSW	7	97716468	missense	probably benign	0.00
R7051:Clns1a	UTSW	7	97712617	splice site	probably null
R7384:Clns1a	UTSW	7	97696781	missense	probably benign	0.00
R8183:Clns1a	UTSW	7	97705681	missense	probably damaging	1.00
R8770:Clns1a	UTSW	7	97713910	missense	probably benign	0.01
R9131:Clns1a	UTSW	7	97713918	missense	probably damaging	0.98
R9328:Clns1a	UTSW	7	97714033	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TTAGCTGCTAGGTCCTGCTG -3'
(R):5'- GGGTGCCATTTAGACTGATAGC -3'

Sequencing Primer
(F):5'- TAGGTCCTGCTGACAGCCTC -3'
(R):5'- CCATTTAGACTGATAGCAGAGAAAC -3'

Posted On

2016-10-26