Incidental Mutation 'R5574:Pias1'
ID 437121
Institutional Source Beutler Lab
Gene Symbol Pias1
Ensembl Gene ENSMUSG00000032405
Gene Name protein inhibitor of activated STAT 1
Synonyms Ddxbp1, GBP, 2900068C24Rik
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 62878368-62987924 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62920493 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 211 (C211R)
Ref Sequence ENSEMBL: ENSMUSP00000149590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098651] [ENSMUST00000214830] [ENSMUST00000216209]
AlphaFold O88907
Predicted Effect possibly damaging
Transcript: ENSMUST00000098651
AA Change: C220R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096248
Gene: ENSMUSG00000032405
AA Change: C220R

DomainStartEndE-ValueType
SAP 11 45 5.3e-5 SMART
low complexity region 82 95 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:PINIT 135 286 9.6e-41 PFAM
Pfam:zf-MIZ 331 380 1.4e-23 PFAM
low complexity region 465 474 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214830
AA Change: C220R

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215455
Predicted Effect probably damaging
Transcript: ENSMUST00000216209
AA Change: C211R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.3847 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial perinatal lethality, reduced body size, decreased susceptibility to viral infection, and increased susceptibility to bacterial infection and LPS-induced endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Pias1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pias1 APN 9 62923296 missense probably damaging 0.96
IGL01011:Pias1 APN 9 62912855 missense probably benign 0.00
IGL02412:Pias1 APN 9 62893139 missense probably benign 0.44
IGL02728:Pias1 APN 9 62923644 missense probably damaging 1.00
IGL02728:Pias1 APN 9 62923645 missense possibly damaging 0.80
piety UTSW 9 62881145 missense
pope UTSW 9 62951860 missense probably damaging 1.00
R0479:Pias1 UTSW 9 62893118 splice site probably benign
R0494:Pias1 UTSW 9 62887311 nonsense probably null
R0524:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R0558:Pias1 UTSW 9 62882009 missense possibly damaging 0.82
R1279:Pias1 UTSW 9 62892145 missense probably damaging 0.98
R1525:Pias1 UTSW 9 62920487 missense probably damaging 1.00
R1769:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R2157:Pias1 UTSW 9 62912830 missense possibly damaging 0.63
R2201:Pias1 UTSW 9 62951855 missense possibly damaging 0.94
R4193:Pias1 UTSW 9 62952004 missense possibly damaging 0.80
R4726:Pias1 UTSW 9 62920489 missense probably damaging 0.96
R4880:Pias1 UTSW 9 62912798 missense probably benign 0.32
R5107:Pias1 UTSW 9 62882228 missense probably benign 0.11
R5634:Pias1 UTSW 9 62895973 missense probably benign 0.10
R5869:Pias1 UTSW 9 62912766 missense probably benign 0.06
R6518:Pias1 UTSW 9 62951860 missense probably damaging 1.00
R6634:Pias1 UTSW 9 62919424 missense probably damaging 1.00
R6798:Pias1 UTSW 9 62892169 missense probably benign
R6799:Pias1 UTSW 9 62882052 missense probably benign 0.10
R7099:Pias1 UTSW 9 62881145 missense
R8350:Pias1 UTSW 9 62951984 missense probably damaging 0.97
R8361:Pias1 UTSW 9 62919386 missense possibly damaging 0.95
R8510:Pias1 UTSW 9 62923637 missense probably damaging 1.00
X0017:Pias1 UTSW 9 62980845 splice site probably null
Z1177:Pias1 UTSW 9 62912823 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCTCCTTGTGGTACTGGAGC -3'
(R):5'- ACAGTTCTGTGCAGTTGTCCC -3'

Sequencing Primer
(F):5'- TGGTACTGGAGCTGAATTCAG -3'
(R):5'- GTGCAATTCAGACCTCTGTTCAATGG -3'
Posted On 2016-10-26