Mutagenetix > Incidental Mutations

Incidental Mutation 'R5574:Pias1'

437121

Institutional Source

Beutler Lab

Gene Symbol

Pias1

Ensembl Gene

ENSMUSG00000032405

Gene Name

protein inhibitor of activated STAT 1

Synonyms

Ddxbp1, GBP, 2900068C24Rik

MMRRC Submission

043129-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R5574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62878368-62987924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62920493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 211 (C211R)

Ref Sequence

ENSEMBL: ENSMUSP00000149590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098651] [ENSMUST00000214830] [ENSMUST00000216209]

AlphaFold

O88907

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098651
AA Change: C220R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000096248
Gene: ENSMUSG00000032405
AA Change: C220R

Domain	Start	End	E-Value	Type
SAP	11	45	5.3e-5	SMART
low complexity region	82	95	N/A	INTRINSIC
low complexity region	103	116	N/A	INTRINSIC
Pfam:PINIT	135	286	9.6e-41	PFAM
Pfam:zf-MIZ	331	380	1.4e-23	PFAM
low complexity region	465	474	N/A	INTRINSIC
low complexity region	482	491	N/A	INTRINSIC
low complexity region	605	621	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000214830
AA Change: C220R

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215455

Predicted Effect

probably damaging
Transcript: ENSMUST00000216209
AA Change: C211R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Meta Mutation Damage Score

0.3847

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial perinatal lethality, reduced body size, decreased susceptibility to viral infection, and increased susceptibility to bacterial infection and LPS-induced endotoxin shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,756	N31I	possibly damaging	Het
3110002H16Rik	CTGTGTGTT	CTGTGTGTTGTGTGTT	18: 12,185,006		probably null	Het
Acvr1b	T	A	15: 101,202,077	M304K	probably benign	Het
Adamts1	G	T	16: 85,799,642	D106E	probably damaging	Het
Blm	C	A	7: 80,499,773	C696F	probably damaging	Het
Bnip3l-ps	T	A	12: 18,217,118		noncoding transcript	Het
C87499	T	G	4: 88,628,043	E354A	probably benign	Het
Ccdc171	A	T	4: 83,693,753	N895I	probably damaging	Het
Cdhr4	A	T	9: 107,993,328		probably benign	Het
Cfap97	T	C	8: 46,170,142	S190P	probably damaging	Het
Chrnb1	A	C	11: 69,793,683		probably benign	Het
Clns1a	A	G	7: 97,720,958		probably benign	Het
Col8a2	G	A	4: 126,311,268		probably benign	Het
Cr2	T	A	1: 195,141,236	E721V	probably damaging	Het
Csk	A	G	9: 57,629,301	V172A	probably benign	Het
Cyp2g1	G	A	7: 26,820,740	V466M	possibly damaging	Het
Cyp4f13	A	G	17: 32,929,205	Y349H	probably benign	Het
Dnm1l	T	C	16: 16,329,821	Y205C	probably damaging	Het
Dync1i2	A	T	2: 71,233,650	T113S	probably benign	Het
Edem2	T	C	2: 155,716,155	E186G	probably damaging	Het
Eya2	G	A	2: 165,763,816	R380H	probably damaging	Het
Fam214a	A	T	9: 75,010,390	D757V	probably damaging	Het
Fam60a	C	T	6: 148,944,880		probably benign	Het
Gldn	A	G	9: 54,312,922	T132A	probably damaging	Het
Gm13941	A	T	2: 111,100,606	I74K	unknown	Het
Gm3898	C	T	9: 43,830,042		noncoding transcript	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Klhdc10	C	T	6: 30,439,865	L127F	possibly damaging	Het
Letm1	G	A	5: 33,769,386	T189M	possibly damaging	Het
Lrrc17	A	T	5: 21,570,357	I306F	possibly damaging	Het
Lrrk2	T	A	15: 91,787,016	V2000E	probably damaging	Het
Mettl9	A	T	7: 121,047,870	E66D	probably benign	Het
Mroh1	T	A	15: 76,433,931	V877D	probably benign	Het
Mycbp2	C	T	14: 103,142,767	V3760M	possibly damaging	Het
Nos3	A	G	5: 24,368,861	T208A	possibly damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Obp2a	A	T	2: 25,700,830	T70S	possibly damaging	Het
Olfr1040	T	C	2: 86,146,191	D181G	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr1245	C	T	2: 89,574,977	V250I	possibly damaging	Het
Olfr145	A	T	9: 37,897,581	Y59F	probably damaging	Het
Olfr69	T	G	7: 103,768,116	I94L	possibly damaging	Het
Pate2	A	G	9: 35,686,115		probably benign	Het
Pdzph1	A	G	17: 58,973,947	F447L	probably benign	Het
Plb1	A	G	5: 32,329,947	S929G	probably benign	Het
Prc1	G	A	7: 80,294,542		probably benign	Het
Prex2	A	G	1: 11,140,058	D574G	probably damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rock2	T	C	12: 16,961,641	M690T	possibly damaging	Het
Slc18a2	A	G	19: 59,261,405	I25V	probably benign	Het
Slc9a5	T	A	8: 105,364,691	I701K	probably benign	Het
Sorcs1	T	A	19: 50,222,133	N765Y	probably damaging	Het
Ssh2	A	T	11: 77,450,115	I698L	probably benign	Het
Stam	A	G	2: 14,115,864	D58G	probably damaging	Het
Thsd4	C	A	9: 59,972,400	R1018L	probably damaging	Het
Tnxb	A	G	17: 34,711,024	T2911A	probably benign	Het
Trpm7	A	C	2: 126,813,030	F1329L	probably benign	Het
Ttll9	A	G	2: 152,984,248	E126G	possibly damaging	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Unc45a	G	A	7: 80,334,856	A232V	probably damaging	Het
Utp14b	G	A	1: 78,666,409	V675M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,891	H279L	probably benign	Het
Vmn2r75	G	T	7: 86,166,302	A118E	probably benign	Het
Wdr36	A	T	18: 32,865,959	Q886L	probably damaging	Het
Zfp433	T	A	10: 81,719,291	Y27*	probably null	Het
Zfp715	A	T	7: 43,311,039	S43T	possibly damaging	Het
Zfyve26	A	G	12: 79,239,924	S2297P	possibly damaging	Het

Other mutations in Pias1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Pias1	APN	9	62923296	missense	probably damaging	0.96
IGL01011:Pias1	APN	9	62912855	missense	probably benign	0.00
IGL02412:Pias1	APN	9	62893139	missense	probably benign	0.44
IGL02728:Pias1	APN	9	62923644	missense	probably damaging	1.00
IGL02728:Pias1	APN	9	62923645	missense	possibly damaging	0.80
piety	UTSW	9	62881145	missense
pope	UTSW	9	62951860	missense	probably damaging	1.00
R0479:Pias1	UTSW	9	62893118	splice site	probably benign
R0494:Pias1	UTSW	9	62887311	nonsense	probably null
R0524:Pias1	UTSW	9	62952178	missense	probably damaging	1.00
R0558:Pias1	UTSW	9	62882009	missense	possibly damaging	0.82
R1279:Pias1	UTSW	9	62892145	missense	probably damaging	0.98
R1525:Pias1	UTSW	9	62920487	missense	probably damaging	1.00
R1769:Pias1	UTSW	9	62952178	missense	probably damaging	1.00
R2157:Pias1	UTSW	9	62912830	missense	possibly damaging	0.63
R2201:Pias1	UTSW	9	62951855	missense	possibly damaging	0.94
R4193:Pias1	UTSW	9	62952004	missense	possibly damaging	0.80
R4726:Pias1	UTSW	9	62920489	missense	probably damaging	0.96
R4880:Pias1	UTSW	9	62912798	missense	probably benign	0.32
R5107:Pias1	UTSW	9	62882228	missense	probably benign	0.11
R5634:Pias1	UTSW	9	62895973	missense	probably benign	0.10
R5869:Pias1	UTSW	9	62912766	missense	probably benign	0.06
R6518:Pias1	UTSW	9	62951860	missense	probably damaging	1.00
R6634:Pias1	UTSW	9	62919424	missense	probably damaging	1.00
R6798:Pias1	UTSW	9	62892169	missense	probably benign
R6799:Pias1	UTSW	9	62882052	missense	probably benign	0.10
R7099:Pias1	UTSW	9	62881145	missense
R8350:Pias1	UTSW	9	62951984	missense	probably damaging	0.97
R8361:Pias1	UTSW	9	62919386	missense	possibly damaging	0.95
R8510:Pias1	UTSW	9	62923637	missense	probably damaging	1.00
X0017:Pias1	UTSW	9	62980845	splice site	probably null
Z1177:Pias1	UTSW	9	62912823	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TCTCCTTGTGGTACTGGAGC -3'
(R):5'- ACAGTTCTGTGCAGTTGTCCC -3'

Sequencing Primer
(F):5'- TGGTACTGGAGCTGAATTCAG -3'
(R):5'- GTGCAATTCAGACCTCTGTTCAATGG -3'

Posted On

2016-10-26