Incidental Mutation 'R5574:Cdhr4'
ID 437123
Institutional Source Beutler Lab
Gene Symbol Cdhr4
Ensembl Gene ENSMUSG00000032595
Gene Name cadherin-related family member 4
Synonyms Cdh29, 1700021K14Rik, D330022A01Rik
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107992497-107999684 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 107993328 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175759] [ENSMUST00000176306] [ENSMUST00000176356] [ENSMUST00000176373] [ENSMUST00000177508] [ENSMUST00000177368] [ENSMUST00000177173]
AlphaFold H3BJZ2
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175729
Predicted Effect probably benign
Transcript: ENSMUST00000175759
SMART Domains Protein: ENSMUSP00000135743
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 3 104 4e-44 BLAST
SCOP:d1l3wa3 59 104 4e-7 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175802
SMART Domains Protein: ENSMUSP00000135003
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
CA 33 116 5.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176196
Predicted Effect probably benign
Transcript: ENSMUST00000176306
Predicted Effect probably benign
Transcript: ENSMUST00000176334
Predicted Effect probably benign
Transcript: ENSMUST00000176356
Predicted Effect probably benign
Transcript: ENSMUST00000176373
SMART Domains Protein: ENSMUSP00000134896
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect probably benign
Transcript: ENSMUST00000176459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177516
Predicted Effect probably benign
Transcript: ENSMUST00000177508
SMART Domains Protein: ENSMUSP00000135332
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 1 29 4e-7 BLAST
transmembrane domain 60 82 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177173
SMART Domains Protein: ENSMUSP00000135184
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Blast:CA 149 224 2e-9 BLAST
Blast:CA 252 330 3e-33 BLAST
CA 354 437 2.24e-1 SMART
CA 459 542 5.86e-17 SMART
Blast:CA 566 649 3e-40 BLAST
transmembrane domain 680 702 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Cdhr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdhr4 APN 9 107999545 missense probably damaging 1.00
IGL01105:Cdhr4 APN 9 107995861 unclassified probably benign
IGL02097:Cdhr4 APN 9 107993000 missense probably benign 0.17
IGL02441:Cdhr4 APN 9 107993267 missense possibly damaging 0.84
IGL02635:Cdhr4 APN 9 107992871 missense probably benign 0.04
IGL02870:Cdhr4 APN 9 107998064 critical splice donor site probably null
IGL03160:Cdhr4 APN 9 107995869 missense probably benign 0.05
IGL03162:Cdhr4 APN 9 107998011 missense probably damaging 1.00
IGL03250:Cdhr4 APN 9 107996659 missense probably damaging 0.99
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R1241:Cdhr4 UTSW 9 107995296 missense probably benign 0.00
R1250:Cdhr4 UTSW 9 107997516 missense probably damaging 1.00
R2102:Cdhr4 UTSW 9 107998007 missense probably damaging 1.00
R2104:Cdhr4 UTSW 9 107996261 missense probably damaging 0.97
R2106:Cdhr4 UTSW 9 107997494 missense possibly damaging 0.75
R2108:Cdhr4 UTSW 9 107997644 missense probably damaging 1.00
R2171:Cdhr4 UTSW 9 107992918 missense probably benign 0.00
R2312:Cdhr4 UTSW 9 107995287 missense probably benign 0.00
R4106:Cdhr4 UTSW 9 107996260 missense probably damaging 1.00
R4515:Cdhr4 UTSW 9 107992951 missense probably benign 0.31
R4686:Cdhr4 UTSW 9 107995684 missense probably benign 0.00
R4799:Cdhr4 UTSW 9 107998699 splice site probably benign
R5165:Cdhr4 UTSW 9 107997630 missense probably damaging 1.00
R5478:Cdhr4 UTSW 9 107995591 missense possibly damaging 0.61
R7387:Cdhr4 UTSW 9 107996912 nonsense probably null
R7609:Cdhr4 UTSW 9 107997283 missense probably damaging 0.99
R7663:Cdhr4 UTSW 9 107998772 nonsense probably null
R8141:Cdhr4 UTSW 9 107996792 missense
R8483:Cdhr4 UTSW 9 107994999 missense probably damaging 1.00
R8493:Cdhr4 UTSW 9 107996254 missense probably damaging 1.00
R8715:Cdhr4 UTSW 9 107997397 missense
R8816:Cdhr4 UTSW 9 107995592 missense possibly damaging 0.56
R9392:Cdhr4 UTSW 9 107996308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGAGTAGCTCTGCTCG -3'
(R):5'- TAAGAGTTTGTGCCTGGGAC -3'

Sequencing Primer
(F):5'- AGTAGCTCTGCTCGGCTGG -3'
(R):5'- ACAGGAGCAGAGCCCTC -3'
Posted On 2016-10-26