Incidental Mutation 'R5574:Chrnb1'
ID 437125
Institutional Source Beutler Lab
Gene Symbol Chrnb1
Ensembl Gene ENSMUSG00000041189
Gene Name cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
Synonyms AChR beta, Acrb, Achr-2
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69784036-69795943 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to C at 69793683 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011285] [ENSMUST00000045971] [ENSMUST00000102585]
AlphaFold P09690
Predicted Effect probably benign
Transcript: ENSMUST00000011285
SMART Domains Protein: ENSMUSP00000011285
Gene: ENSMUSG00000042826

DomainStartEndE-ValueType
FGF 69 172 6.95e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045971
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102585
SMART Domains Protein: ENSMUSP00000099645
Gene: ENSMUSG00000042826

DomainStartEndE-ValueType
FGF 69 200 3.43e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154816
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele lack all tyrosine residues in the beta subunit intracellular loop, display reduced and simplified neuromuscular junctions, and show defective acetylcholine receptor clustering and anchoring at synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Chrnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Chrnb1 APN 11 69793916 missense probably damaging 1.00
IGL01924:Chrnb1 APN 11 69795019 unclassified probably benign
IGL01983:Chrnb1 APN 11 69795729 missense probably benign 0.27
IGL02100:Chrnb1 APN 11 69793455 unclassified probably benign
IGL02507:Chrnb1 APN 11 69785090 missense probably damaging 1.00
IGL02814:Chrnb1 APN 11 69795680 missense probably damaging 1.00
IGL02858:Chrnb1 APN 11 69785109 missense possibly damaging 0.58
R0368:Chrnb1 UTSW 11 69784757 missense probably damaging 1.00
R1728:Chrnb1 UTSW 11 69785762 missense probably damaging 1.00
R1913:Chrnb1 UTSW 11 69793584 missense possibly damaging 0.95
R1930:Chrnb1 UTSW 11 69792737 missense possibly damaging 0.81
R2233:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R2234:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R3971:Chrnb1 UTSW 11 69792916 unclassified probably benign
R4183:Chrnb1 UTSW 11 69787096 missense possibly damaging 0.50
R4425:Chrnb1 UTSW 11 69786947 missense probably damaging 1.00
R4822:Chrnb1 UTSW 11 69795675 missense possibly damaging 0.55
R4983:Chrnb1 UTSW 11 69793978 missense probably damaging 1.00
R5000:Chrnb1 UTSW 11 69787032 missense probably damaging 0.96
R5378:Chrnb1 UTSW 11 69785181 missense probably benign 0.00
R5396:Chrnb1 UTSW 11 69794153 missense probably damaging 1.00
R5540:Chrnb1 UTSW 11 69795650 missense probably benign 0.30
R5890:Chrnb1 UTSW 11 69792729 missense possibly damaging 0.94
R5973:Chrnb1 UTSW 11 69795845 unclassified probably benign
R6056:Chrnb1 UTSW 11 69786939 missense probably damaging 1.00
R7466:Chrnb1 UTSW 11 69784650 missense probably damaging 1.00
R7633:Chrnb1 UTSW 11 69792873 missense probably damaging 1.00
R7664:Chrnb1 UTSW 11 69787024 missense possibly damaging 0.80
R8266:Chrnb1 UTSW 11 69784621 makesense probably null
R9124:Chrnb1 UTSW 11 69794231 missense probably benign 0.31
Z1177:Chrnb1 UTSW 11 69794189 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTTCATGAATGTAGACTTCCTGC -3'
(R):5'- AGCTTTTGTCTGACCTCAGG -3'

Sequencing Primer
(F):5'- ATGAATGTAGACTTCCTGCCTCTC -3'
(R):5'- AGGCTTCCTGACTCCCCAG -3'
Posted On 2016-10-26