Mutagenetix > Incidental Mutations

Incidental Mutation 'R5574:Ssh2'

437126

Institutional Source

Beutler Lab

Gene Symbol

Ssh2

Ensembl Gene

ENSMUSG00000037926

Gene Name

slingshot protein phosphatase 2

Synonyms

SSH-2

MMRRC Submission

043129-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R5574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77216287-77460220 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77450115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 698 (I698L)

Ref Sequence

ENSEMBL: ENSMUSP00000137933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]

AlphaFold

Q5SW75

Predicted Effect

probably benign
Transcript: ENSMUST00000037912
AA Change: I692L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: I692L

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
Pfam:DEK_C	251	302	3.1e-13	PFAM
DSPc	307	445	2.2e-41	SMART
low complexity region	459	469	N/A	INTRINSIC
low complexity region	871	882	N/A	INTRINSIC
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000181283
AA Change: I698L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: I698L

Domain	Start	End	E-Value	Type
Pfam:DEK_C	256	309	1.7e-18	PFAM
DSPc	313	451	2.2e-41	SMART
low complexity region	465	475	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1376	1391	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,756	N31I	possibly damaging	Het
3110002H16Rik	CTGTGTGTT	CTGTGTGTTGTGTGTT	18: 12,185,006		probably null	Het
Acvr1b	T	A	15: 101,202,077	M304K	probably benign	Het
Adamts1	G	T	16: 85,799,642	D106E	probably damaging	Het
Blm	C	A	7: 80,499,773	C696F	probably damaging	Het
Bnip3l-ps	T	A	12: 18,217,118		noncoding transcript	Het
C87499	T	G	4: 88,628,043	E354A	probably benign	Het
Ccdc171	A	T	4: 83,693,753	N895I	probably damaging	Het
Cdhr4	A	T	9: 107,993,328		probably benign	Het
Cfap97	T	C	8: 46,170,142	S190P	probably damaging	Het
Chrnb1	A	C	11: 69,793,683		probably benign	Het
Clns1a	A	G	7: 97,720,958		probably benign	Het
Col8a2	G	A	4: 126,311,268		probably benign	Het
Cr2	T	A	1: 195,141,236	E721V	probably damaging	Het
Csk	A	G	9: 57,629,301	V172A	probably benign	Het
Cyp2g1	G	A	7: 26,820,740	V466M	possibly damaging	Het
Cyp4f13	A	G	17: 32,929,205	Y349H	probably benign	Het
Dnm1l	T	C	16: 16,329,821	Y205C	probably damaging	Het
Dync1i2	A	T	2: 71,233,650	T113S	probably benign	Het
Edem2	T	C	2: 155,716,155	E186G	probably damaging	Het
Eya2	G	A	2: 165,763,816	R380H	probably damaging	Het
Fam214a	A	T	9: 75,010,390	D757V	probably damaging	Het
Fam60a	C	T	6: 148,944,880		probably benign	Het
Gldn	A	G	9: 54,312,922	T132A	probably damaging	Het
Gm13941	A	T	2: 111,100,606	I74K	unknown	Het
Gm3898	C	T	9: 43,830,042		noncoding transcript	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Klhdc10	C	T	6: 30,439,865	L127F	possibly damaging	Het
Letm1	G	A	5: 33,769,386	T189M	possibly damaging	Het
Lrrc17	A	T	5: 21,570,357	I306F	possibly damaging	Het
Lrrk2	T	A	15: 91,787,016	V2000E	probably damaging	Het
Mettl9	A	T	7: 121,047,870	E66D	probably benign	Het
Mroh1	T	A	15: 76,433,931	V877D	probably benign	Het
Mycbp2	C	T	14: 103,142,767	V3760M	possibly damaging	Het
Nos3	A	G	5: 24,368,861	T208A	possibly damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Obp2a	A	T	2: 25,700,830	T70S	possibly damaging	Het
Olfr1040	T	C	2: 86,146,191	D181G	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr1245	C	T	2: 89,574,977	V250I	possibly damaging	Het
Olfr145	A	T	9: 37,897,581	Y59F	probably damaging	Het
Olfr69	T	G	7: 103,768,116	I94L	possibly damaging	Het
Pate2	A	G	9: 35,686,115		probably benign	Het
Pdzph1	A	G	17: 58,973,947	F447L	probably benign	Het
Pias1	A	G	9: 62,920,493	C211R	probably damaging	Het
Plb1	A	G	5: 32,329,947	S929G	probably benign	Het
Prc1	G	A	7: 80,294,542		probably benign	Het
Prex2	A	G	1: 11,140,058	D574G	probably damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rock2	T	C	12: 16,961,641	M690T	possibly damaging	Het
Slc18a2	A	G	19: 59,261,405	I25V	probably benign	Het
Slc9a5	T	A	8: 105,364,691	I701K	probably benign	Het
Sorcs1	T	A	19: 50,222,133	N765Y	probably damaging	Het
Stam	A	G	2: 14,115,864	D58G	probably damaging	Het
Thsd4	C	A	9: 59,972,400	R1018L	probably damaging	Het
Tnxb	A	G	17: 34,711,024	T2911A	probably benign	Het
Trpm7	A	C	2: 126,813,030	F1329L	probably benign	Het
Ttll9	A	G	2: 152,984,248	E126G	possibly damaging	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Unc45a	G	A	7: 80,334,856	A232V	probably damaging	Het
Utp14b	G	A	1: 78,666,409	V675M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,891	H279L	probably benign	Het
Vmn2r75	G	T	7: 86,166,302	A118E	probably benign	Het
Wdr36	A	T	18: 32,865,959	Q886L	probably damaging	Het
Zfp433	T	A	10: 81,719,291	Y27*	probably null	Het
Zfp715	A	T	7: 43,311,039	S43T	possibly damaging	Het
Zfyve26	A	G	12: 79,239,924	S2297P	possibly damaging	Het

Other mutations in Ssh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Ssh2	APN	11	77441926	missense	probably damaging	1.00
IGL01141:Ssh2	APN	11	77449726	missense	probably damaging	1.00
IGL01520:Ssh2	APN	11	77449906	missense	probably damaging	1.00
IGL01803:Ssh2	APN	11	77425330	missense	probably damaging	0.99
IGL01989:Ssh2	APN	11	77453685	missense	possibly damaging	0.79
IGL02322:Ssh2	APN	11	77416413	critical splice acceptor site	probably null
IGL02466:Ssh2	APN	11	77416407	splice site	probably benign
IGL02683:Ssh2	APN	11	77398256	missense	probably damaging	0.99
IGL02706:Ssh2	APN	11	77453406	missense	possibly damaging	0.68
IGL02719:Ssh2	APN	11	77425587	missense	probably damaging	1.00
IGL02721:Ssh2	APN	11	77454725	nonsense	probably null
IGL02732:Ssh2	APN	11	77437776	splice site	probably null
IGL02745:Ssh2	APN	11	77455407	missense	probably damaging	1.00
IGL02993:Ssh2	APN	11	77453544	missense	probably damaging	1.00
IGL03000:Ssh2	APN	11	77421206	splice site	probably benign
david	UTSW	11	77425593	missense	probably damaging	1.00
faba	UTSW	11	77441985	missense	probably damaging	1.00
goliath	UTSW	11	77453523	missense	possibly damaging	0.48
Vicia	UTSW	11	77454966	missense	possibly damaging	0.68
IGL03055:Ssh2	UTSW	11	77408195	nonsense	probably null
R0024:Ssh2	UTSW	11	77454966	missense	possibly damaging	0.68
R0374:Ssh2	UTSW	11	77408143	missense	probably damaging	1.00
R0539:Ssh2	UTSW	11	77454794	missense	probably benign	0.11
R0834:Ssh2	UTSW	11	77437633	missense	possibly damaging	0.87
R1714:Ssh2	UTSW	11	77454024	missense	possibly damaging	0.94
R1743:Ssh2	UTSW	11	77437756	missense	probably damaging	1.00
R1889:Ssh2	UTSW	11	77449745	missense	probably damaging	1.00
R1895:Ssh2	UTSW	11	77449745	missense	probably damaging	1.00
R3945:Ssh2	UTSW	11	77454668	missense	possibly damaging	0.93
R3947:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R3948:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R4133:Ssh2	UTSW	11	77421269	missense	probably damaging	1.00
R4256:Ssh2	UTSW	11	77408183	missense	possibly damaging	0.48
R4499:Ssh2	UTSW	11	77393067	nonsense	probably null
R4548:Ssh2	UTSW	11	77450184	missense	probably benign	0.20
R4644:Ssh2	UTSW	11	77449576	missense	possibly damaging	0.46
R4690:Ssh2	UTSW	11	77455205	missense	possibly damaging	0.62
R4788:Ssh2	UTSW	11	77429798	missense	probably damaging	1.00
R4919:Ssh2	UTSW	11	77425320	missense	possibly damaging	0.91
R5014:Ssh2	UTSW	11	77455276	nonsense	probably null
R5380:Ssh2	UTSW	11	77453945	missense	probably benign	0.01
R5593:Ssh2	UTSW	11	77421366	missense	probably damaging	0.99
R5739:Ssh2	UTSW	11	77449813	missense	probably damaging	1.00
R6180:Ssh2	UTSW	11	77453465	missense	probably benign	0.43
R6542:Ssh2	UTSW	11	77450150	missense	possibly damaging	0.94
R6713:Ssh2	UTSW	11	77449433	missense	possibly damaging	0.89
R7108:Ssh2	UTSW	11	77454794	missense	probably benign
R7124:Ssh2	UTSW	11	77454338	missense	probably benign	0.00
R7255:Ssh2	UTSW	11	77425593	missense	probably damaging	1.00
R7332:Ssh2	UTSW	11	77453523	missense	possibly damaging	0.48
R7362:Ssh2	UTSW	11	77449650	missense	probably benign	0.01
R7395:Ssh2	UTSW	11	77393073	missense	probably damaging	0.99
R7412:Ssh2	UTSW	11	77450108	missense	probably damaging	0.98
R7493:Ssh2	UTSW	11	77437716	missense	probably benign	0.16
R7686:Ssh2	UTSW	11	77425324	missense	possibly damaging	0.89
R7870:Ssh2	UTSW	11	77453615	missense	probably benign
R7895:Ssh2	UTSW	11	77454626	missense	probably benign	0.41
R7963:Ssh2	UTSW	11	77421356	missense	possibly damaging	0.93
R8030:Ssh2	UTSW	11	77454506	missense	probably benign	0.01
R8065:Ssh2	UTSW	11	77441985	missense	probably damaging	1.00
R8099:Ssh2	UTSW	11	77454929	nonsense	probably null
R8294:Ssh2	UTSW	11	77454201	missense	probably benign	0.08
R8464:Ssh2	UTSW	11	77454253	nonsense	probably null
R8469:Ssh2	UTSW	11	77449608	missense	probably benign	0.41
R8547:Ssh2	UTSW	11	77449707	missense	probably benign	0.10
R8677:Ssh2	UTSW	11	77455193	missense	possibly damaging	0.77
R8758:Ssh2	UTSW	11	77454017	missense	probably benign
R9029:Ssh2	UTSW	11	77437628	missense	probably damaging	1.00
R9030:Ssh2	UTSW	11	77421236	missense	possibly damaging	0.63
R9126:Ssh2	UTSW	11	77455276	nonsense	probably null
R9146:Ssh2	UTSW	11	77437676	missense	probably damaging	0.98
R9377:Ssh2	UTSW	11	77408148	missense	possibly damaging	0.95
RF018:Ssh2	UTSW	11	77454054	missense	probably damaging	0.99
X0017:Ssh2	UTSW	11	77441898	missense	probably damaging	1.00
Z1088:Ssh2	UTSW	11	77449495	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAAAGACCTCCCCATGTC -3'
(R):5'- GGCATTAACACAGCAAAGTCTC -3'

Sequencing Primer
(F):5'- ATGTCACCTGATCTGGAGTCAC -3'
(R):5'- GCAAAGTCTCCAATAGTTTCTTGGG -3'

Posted On

2016-10-26