Incidental Mutation 'R5574:Zfyve26'
ID 437129
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Name zinc finger, FYVE domain containing 26
Synonyms A630028O16Rik, 9330197E15Rik, LOC380767
MMRRC Submission 043129-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 79279120-79343078 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79286698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2297 (S2297P)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]
AlphaFold Q5DU37
Predicted Effect possibly damaging
Transcript: ENSMUST00000021547
AA Change: S2297P

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: S2297P

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220390
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,380,205 (GRCm39) N31I possibly damaging Het
Acvr1b T A 15: 101,099,958 (GRCm39) M304K probably benign Het
Adamts1 G T 16: 85,596,530 (GRCm39) D106E probably damaging Het
Atosa A T 9: 74,917,672 (GRCm39) D757V probably damaging Het
Blm C A 7: 80,149,521 (GRCm39) C696F probably damaging Het
Bnip3l-ps T A 12: 18,267,119 (GRCm39) noncoding transcript Het
Ccdc171 A T 4: 83,611,990 (GRCm39) N895I probably damaging Het
Cdhr4 A T 9: 107,870,527 (GRCm39) probably benign Het
Cfap97 T C 8: 46,623,179 (GRCm39) S190P probably damaging Het
Chrnb1 A C 11: 69,684,509 (GRCm39) probably benign Het
Clns1a A G 7: 97,370,165 (GRCm39) probably benign Het
Col8a2 G A 4: 126,205,061 (GRCm39) probably benign Het
Cr2 T A 1: 194,823,544 (GRCm39) E721V probably damaging Het
Csk A G 9: 57,536,584 (GRCm39) V172A probably benign Het
Cyp2g1 G A 7: 26,520,165 (GRCm39) V466M possibly damaging Het
Cyp4f13 A G 17: 33,148,179 (GRCm39) Y349H probably benign Het
Dnm1l T C 16: 16,147,685 (GRCm39) Y205C probably damaging Het
Dync1i2 A T 2: 71,063,994 (GRCm39) T113S probably benign Het
Edem2 T C 2: 155,558,075 (GRCm39) E186G probably damaging Het
Eya2 G A 2: 165,605,736 (GRCm39) R380H probably damaging Het
Gldn A G 9: 54,220,206 (GRCm39) T132A probably damaging Het
Gm13941 A T 2: 110,930,951 (GRCm39) I74K unknown Het
Gm3898 C T 9: 43,741,339 (GRCm39) noncoding transcript Het
Ighmbp2 C T 19: 3,321,536 (GRCm39) V408I probably benign Het
Klhdc10 C T 6: 30,439,864 (GRCm39) L127F possibly damaging Het
Letm1 G A 5: 33,926,730 (GRCm39) T189M possibly damaging Het
Lrrc17 A T 5: 21,775,355 (GRCm39) I306F possibly damaging Het
Lrrk2 T A 15: 91,671,219 (GRCm39) V2000E probably damaging Het
Mettl9 A T 7: 120,647,093 (GRCm39) E66D probably benign Het
Mroh1 T A 15: 76,318,131 (GRCm39) V877D probably benign Het
Mycbp2 C T 14: 103,380,203 (GRCm39) V3760M possibly damaging Het
Nos3 A G 5: 24,573,859 (GRCm39) T208A possibly damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Obp2a A T 2: 25,590,842 (GRCm39) T70S possibly damaging Het
Or4a72 C T 2: 89,405,321 (GRCm39) V250I possibly damaging Het
Or52a5b T G 7: 103,417,323 (GRCm39) I94L possibly damaging Het
Or5al6 T C 2: 85,976,535 (GRCm39) D181G probably damaging Het
Or8b8 A T 9: 37,808,877 (GRCm39) Y59F probably damaging Het
Or8h10 A G 2: 86,808,867 (GRCm39) V91A probably benign Het
Pate2 A G 9: 35,597,411 (GRCm39) probably benign Het
Pdzph1 A G 17: 59,280,942 (GRCm39) F447L probably benign Het
Pias1 A G 9: 62,827,775 (GRCm39) C211R probably damaging Het
Plb1 A G 5: 32,487,291 (GRCm39) S929G probably benign Het
Pramel32 T G 4: 88,546,280 (GRCm39) E354A probably benign Het
Prc1 G A 7: 79,944,290 (GRCm39) probably benign Het
Prex2 A G 1: 11,210,282 (GRCm39) D574G probably damaging Het
Rapgef4 G A 2: 71,864,464 (GRCm39) probably null Het
Rmc1 CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,318,063 (GRCm39) probably null Het
Rock2 T C 12: 17,011,642 (GRCm39) M690T possibly damaging Het
Sinhcaf C T 6: 148,846,378 (GRCm39) probably benign Het
Slc18a2 A G 19: 59,249,837 (GRCm39) I25V probably benign Het
Slc9a5 T A 8: 106,091,323 (GRCm39) I701K probably benign Het
Sorcs1 T A 19: 50,210,571 (GRCm39) N765Y probably damaging Het
Ssh2 A T 11: 77,340,941 (GRCm39) I698L probably benign Het
Stam A G 2: 14,120,675 (GRCm39) D58G probably damaging Het
Thsd4 C A 9: 59,879,683 (GRCm39) R1018L probably damaging Het
Tnxb A G 17: 34,929,998 (GRCm39) T2911A probably benign Het
Trpm7 A C 2: 126,654,950 (GRCm39) F1329L probably benign Het
Ttll9 A G 2: 152,826,168 (GRCm39) E126G possibly damaging Het
Tubgcp5 G A 7: 55,455,077 (GRCm39) V258M probably benign Het
Unc45a G A 7: 79,984,604 (GRCm39) A232V probably damaging Het
Utp14b G A 1: 78,644,126 (GRCm39) V675M probably damaging Het
Vmn2r67 T A 7: 84,801,099 (GRCm39) H279L probably benign Het
Vmn2r75 G T 7: 85,815,510 (GRCm39) A118E probably benign Het
Wdr36 A T 18: 32,999,012 (GRCm39) Q886L probably damaging Het
Zfp433 T A 10: 81,555,125 (GRCm39) Y27* probably null Het
Zfp715 A T 7: 42,960,463 (GRCm39) S43T possibly damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79,296,234 (GRCm39) unclassified probably benign
IGL00940:Zfyve26 APN 12 79,327,674 (GRCm39) missense probably benign
IGL01148:Zfyve26 APN 12 79,307,644 (GRCm39) missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79,298,957 (GRCm39) splice site probably null
IGL01472:Zfyve26 APN 12 79,323,117 (GRCm39) missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79,291,147 (GRCm39) missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79,334,625 (GRCm39) missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79,308,348 (GRCm39) splice site probably null
IGL01689:Zfyve26 APN 12 79,330,827 (GRCm39) missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79,334,218 (GRCm39) missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79,291,174 (GRCm39) missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79,323,169 (GRCm39) missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79,315,621 (GRCm39) missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79,326,854 (GRCm39) missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79,285,794 (GRCm39) missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79,310,644 (GRCm39) missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79,308,565 (GRCm39) missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79,342,338 (GRCm39) missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79,330,846 (GRCm39) nonsense probably null
challenge UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
fourteener UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
IGL02799:Zfyve26 UTSW 12 79,320,084 (GRCm39) missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79,323,055 (GRCm39) missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79,291,258 (GRCm39) missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79,292,996 (GRCm39) missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79,315,502 (GRCm39) missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79,312,576 (GRCm39) splice site probably benign
R0738:Zfyve26 UTSW 12 79,342,308 (GRCm39) missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79,320,372 (GRCm39) missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79,318,901 (GRCm39) missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79,310,723 (GRCm39) missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79,321,694 (GRCm39) missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79,329,591 (GRCm39) missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79,298,937 (GRCm39) missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79,298,925 (GRCm39) missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79,334,535 (GRCm39) missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79,285,718 (GRCm39) missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79,325,237 (GRCm39) missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79,315,823 (GRCm39) missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79,333,032 (GRCm39) missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79,311,125 (GRCm39) missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79,286,744 (GRCm39) nonsense probably null
R1982:Zfyve26 UTSW 12 79,302,017 (GRCm39) missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79,330,806 (GRCm39) splice site probably null
R2071:Zfyve26 UTSW 12 79,334,220 (GRCm39) missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79,292,826 (GRCm39) missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79,292,861 (GRCm39) missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79,321,814 (GRCm39) missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79,330,890 (GRCm39) missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79,329,573 (GRCm39) splice site probably null
R3084:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R3086:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R4626:Zfyve26 UTSW 12 79,315,844 (GRCm39) missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79,291,170 (GRCm39) missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79,296,469 (GRCm39) splice site probably null
R4926:Zfyve26 UTSW 12 79,321,785 (GRCm39) missense probably benign
R4990:Zfyve26 UTSW 12 79,334,607 (GRCm39) missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79,327,159 (GRCm39) nonsense probably null
R5029:Zfyve26 UTSW 12 79,333,097 (GRCm39) missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79,302,135 (GRCm39) missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79,326,832 (GRCm39) nonsense probably null
R5252:Zfyve26 UTSW 12 79,315,756 (GRCm39) missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79,317,624 (GRCm39) missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79,293,295 (GRCm39) missense probably damaging 1.00
R5735:Zfyve26 UTSW 12 79,320,147 (GRCm39) missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79,311,131 (GRCm39) missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79,334,511 (GRCm39) missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79,313,311 (GRCm39) missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79,340,628 (GRCm39) missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79,315,501 (GRCm39) missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79,296,373 (GRCm39) missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79,286,776 (GRCm39) missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79,285,109 (GRCm39) missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79,313,223 (GRCm39) missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79,330,926 (GRCm39) missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79,325,888 (GRCm39) missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79,327,179 (GRCm39) missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79,315,182 (GRCm39) missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79,292,945 (GRCm39) missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79,325,146 (GRCm39) splice site probably null
R7299:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79,297,942 (GRCm39) missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79,286,828 (GRCm39) missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79,334,581 (GRCm39) missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79,315,450 (GRCm39) missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79,337,731 (GRCm39) missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79,315,409 (GRCm39) missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79,327,129 (GRCm39) critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79,302,098 (GRCm39) missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79,315,331 (GRCm39) missense possibly damaging 0.79
R8190:Zfyve26 UTSW 12 79,327,610 (GRCm39) missense probably benign 0.00
R8207:Zfyve26 UTSW 12 79,307,605 (GRCm39) missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
R8500:Zfyve26 UTSW 12 79,334,454 (GRCm39) missense probably damaging 0.99
R8686:Zfyve26 UTSW 12 79,334,227 (GRCm39) missense probably benign
R8758:Zfyve26 UTSW 12 79,311,083 (GRCm39) critical splice donor site probably benign
R8826:Zfyve26 UTSW 12 79,285,742 (GRCm39) missense probably benign 0.05
R8877:Zfyve26 UTSW 12 79,334,152 (GRCm39) missense probably benign 0.05
R9067:Zfyve26 UTSW 12 79,318,915 (GRCm39) missense probably damaging 0.99
R9195:Zfyve26 UTSW 12 79,311,168 (GRCm39) missense probably benign 0.12
R9269:Zfyve26 UTSW 12 79,323,076 (GRCm39) missense possibly damaging 0.73
R9273:Zfyve26 UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
R9340:Zfyve26 UTSW 12 79,321,680 (GRCm39) nonsense probably null
R9348:Zfyve26 UTSW 12 79,315,231 (GRCm39) missense possibly damaging 0.81
R9482:Zfyve26 UTSW 12 79,291,239 (GRCm39) missense probably damaging 1.00
R9536:Zfyve26 UTSW 12 79,298,046 (GRCm39) missense probably benign 0.32
R9653:Zfyve26 UTSW 12 79,334,418 (GRCm39) missense probably benign
R9676:Zfyve26 UTSW 12 79,330,959 (GRCm39) missense probably benign 0.01
R9797:Zfyve26 UTSW 12 79,293,006 (GRCm39) missense probably damaging 0.98
RF010:Zfyve26 UTSW 12 79,302,112 (GRCm39) missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79,285,779 (GRCm39) missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79,315,307 (GRCm39) missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79,334,149 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTAGCATGTGATCTTAATTCC -3'
(R):5'- TGAAGGCCTGCTGTGACTTC -3'

Sequencing Primer
(F):5'- GTAGCATGTGATCTTAATTCCTCTCC -3'
(R):5'- GCTGTGACTTCTCATGACAAAC -3'
Posted On 2016-10-26