Incidental Mutation 'R5574:Mroh1'
ID437132
Institutional Source Beutler Lab
Gene Symbol Mroh1
Ensembl Gene ENSMUSG00000022558
Gene Namemaestro heat-like repeat family member 1
SynonymsHeatr7a, D330001F17Rik
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5574 (G1)
Quality Score158
Status Validated
Chromosome15
Chromosomal Location76380261-76453038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76433931 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 877 (V877D)
Ref Sequence ENSEMBL: ENSMUSP00000154882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092595] [ENSMUST00000096385] [ENSMUST00000159218] [ENSMUST00000160631] [ENSMUST00000161305]
Predicted Effect probably benign
Transcript: ENSMUST00000092595
AA Change: V877D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090256
Gene: ENSMUSG00000022558
AA Change: V877D

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 435 4e-10 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
AA Change: V886D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558
AA Change: V886D

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159218
AA Change: V877D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124811
Gene: ENSMUSG00000022558
AA Change: V877D

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1346 1358 N/A INTRINSIC
low complexity region 1479 1493 N/A INTRINSIC
Pfam:HEAT 1601 1631 1.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160631
SMART Domains Protein: ENSMUSP00000123806
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect probably benign
Transcript: ENSMUST00000161305
AA Change: V877D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183412
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Mroh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Mroh1 APN 15 76432288 missense probably benign 0.01
IGL02141:Mroh1 APN 15 76446599 missense possibly damaging 0.47
IGL02146:Mroh1 APN 15 76434679 splice site probably benign
IGL02205:Mroh1 APN 15 76437239 missense possibly damaging 0.81
IGL02261:Mroh1 APN 15 76429160 missense probably benign 0.03
IGL02818:Mroh1 APN 15 76432401 splice site probably null
IGL02949:Mroh1 APN 15 76408968 missense probably damaging 0.97
IGL02951:Mroh1 APN 15 76427636 missense probably damaging 1.00
IGL03154:Mroh1 APN 15 76452838 missense probably damaging 1.00
IGL02799:Mroh1 UTSW 15 76392461 critical splice donor site probably null
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0076:Mroh1 UTSW 15 76451140 missense probably benign 0.00
R0180:Mroh1 UTSW 15 76428250 missense probably damaging 0.99
R0315:Mroh1 UTSW 15 76427600 missense possibly damaging 0.94
R0350:Mroh1 UTSW 15 76432249 missense probably damaging 0.98
R0399:Mroh1 UTSW 15 76452099 missense probably benign 0.44
R0835:Mroh1 UTSW 15 76451883 missense probably damaging 0.96
R0893:Mroh1 UTSW 15 76408938 missense possibly damaging 0.62
R1109:Mroh1 UTSW 15 76446509 splice site probably benign
R1527:Mroh1 UTSW 15 76452263 missense probably benign 0.03
R1595:Mroh1 UTSW 15 76433530 splice site probably benign
R1900:Mroh1 UTSW 15 76433385 missense probably benign 0.00
R1901:Mroh1 UTSW 15 76436049 missense probably benign
R2223:Mroh1 UTSW 15 76408045 critical splice donor site probably null
R2415:Mroh1 UTSW 15 76421211 missense probably damaging 0.99
R3113:Mroh1 UTSW 15 76408536 splice site probably benign
R3437:Mroh1 UTSW 15 76433608 missense possibly damaging 0.92
R3618:Mroh1 UTSW 15 76452346 missense possibly damaging 0.55
R3833:Mroh1 UTSW 15 76401619 missense probably benign 0.08
R4073:Mroh1 UTSW 15 76407985 missense probably benign 0.13
R4156:Mroh1 UTSW 15 76402126 splice site probably null
R4276:Mroh1 UTSW 15 76393851 missense probably damaging 1.00
R4745:Mroh1 UTSW 15 76408530 critical splice donor site probably null
R5450:Mroh1 UTSW 15 76432347 intron probably benign
R5673:Mroh1 UTSW 15 76430181 missense probably damaging 1.00
R5970:Mroh1 UTSW 15 76451491 missense probably benign 0.24
R5993:Mroh1 UTSW 15 76446680 missense probably damaging 0.99
R6008:Mroh1 UTSW 15 76451357 missense possibly damaging 0.50
R6082:Mroh1 UTSW 15 76430223 missense probably benign 0.06
R6302:Mroh1 UTSW 15 76436119 critical splice donor site probably null
R7030:Mroh1 UTSW 15 76437317 missense probably benign 0.01
R7098:Mroh1 UTSW 15 76408457 nonsense probably null
R7334:Mroh1 UTSW 15 76427638 missense probably benign 0.00
R7337:Mroh1 UTSW 15 76451476 missense probably benign 0.00
R7352:Mroh1 UTSW 15 76451474 missense probably benign 0.06
R7446:Mroh1 UTSW 15 76452272 missense possibly damaging 0.93
R7453:Mroh1 UTSW 15 76433545 missense probably damaging 1.00
R7669:Mroh1 UTSW 15 76451848 missense possibly damaging 0.88
R7753:Mroh1 UTSW 15 76433275 missense possibly damaging 0.62
R7860:Mroh1 UTSW 15 76447332 missense probably benign 0.00
R7990:Mroh1 UTSW 15 76452275 missense probably damaging 1.00
R8140:Mroh1 UTSW 15 76433873 missense probably benign 0.00
R8325:Mroh1 UTSW 15 76432215 frame shift probably null
R8334:Mroh1 UTSW 15 76446556 missense probably benign
Z1177:Mroh1 UTSW 15 76423761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTGAACGTAATGGTAGCTGG -3'
(R):5'- AGTCTTCAAGGGCACACACC -3'

Sequencing Primer
(F):5'- ATCCATGTAGGCCCAGTGGTTTC -3'
(R):5'- CACCGTGTCCAGATACAGAGG -3'
Posted On2016-10-26