Incidental Mutation 'R5574:Dnm1l'
ID437135
Institutional Source Beutler Lab
Gene Symbol Dnm1l
Ensembl Gene ENSMUSG00000022789
Gene Namedynamin 1-like
Synonyms6330417M19Rik, python, Dnmlp1, Drp1
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5574 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16312230-16358959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16329821 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 205 (Y205C)
Ref Sequence ENSEMBL: ENSMUSP00000111415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023477] [ENSMUST00000096229] [ENSMUST00000115749] [ENSMUST00000230022] [ENSMUST00000230980]
Predicted Effect probably damaging
Transcript: ENSMUST00000023477
AA Change: Y354C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023477
Gene: ENSMUSG00000022789
AA Change: Y354C

DomainStartEndE-ValueType
DYNc 1 255 9.83e-124 SMART
low complexity region 556 571 N/A INTRINSIC
GED 602 693 2.52e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096229
AA Change: Y367C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093945
Gene: ENSMUSG00000022789
AA Change: Y367C

DomainStartEndE-ValueType
DYNc 1 268 1.75e-120 SMART
low complexity region 569 584 N/A INTRINSIC
GED 615 706 2.52e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115749
AA Change: Y205C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111415
Gene: ENSMUSG00000022789
AA Change: Y205C

DomainStartEndE-ValueType
DYNc 1 261 2.08e-122 SMART
low complexity region 573 588 N/A INTRINSIC
GED 619 710 2.52e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230022
AA Change: Y256C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000230980
AA Change: Y360C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.3685 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family. The encoded protein is localized to the cytoplasm and mitochondrial membrane, is involved in mitochondrial and peroxisomal division, and is essential for mitochondrial fission. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E11.5 with internal hemorrhage and small size. Mice heterozygous for an ENU induced allele have dilated cardiomyopathy and congestive heart failure, homozygous are embryonic lethal with posterior truncation at E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Ccdc171 A T 4: 83,693,753 N895I probably damaging Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Dnm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Dnm1l APN 16 16333827 critical splice donor site probably null
IGL00696:Dnm1l APN 16 16342715 missense probably benign
IGL01146:Dnm1l APN 16 16314325 missense probably benign 0.01
IGL01385:Dnm1l APN 16 16341453 missense probably damaging 1.00
IGL01694:Dnm1l APN 16 16316651 missense probably benign 0.08
IGL02250:Dnm1l APN 16 16321686 splice site probably benign
IGL02335:Dnm1l APN 16 16342740 intron probably benign
IGL02345:Dnm1l APN 16 16329894 missense possibly damaging 0.61
IGL02403:Dnm1l APN 16 16336976 missense possibly damaging 0.78
IGL02684:Dnm1l APN 16 16321657 missense possibly damaging 0.95
IGL02869:Dnm1l APN 16 16341424 nonsense probably null
IGL03388:Dnm1l APN 16 16314052 splice site probably benign
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R1259:Dnm1l UTSW 16 16324006 missense possibly damaging 0.67
R1554:Dnm1l UTSW 16 16341426 missense probably benign 0.13
R1756:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R1913:Dnm1l UTSW 16 16329966 missense probably benign 0.45
R2906:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R2907:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R3756:Dnm1l UTSW 16 16321612 missense possibly damaging 0.86
R4226:Dnm1l UTSW 16 16314387 missense possibly damaging 0.80
R4414:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R5287:Dnm1l UTSW 16 16333868 missense probably damaging 1.00
R5653:Dnm1l UTSW 16 16319489 missense probably damaging 1.00
R6113:Dnm1l UTSW 16 16341003 missense probably benign 0.00
R6320:Dnm1l UTSW 16 16332088 missense probably damaging 1.00
R6644:Dnm1l UTSW 16 16329873 missense probably benign 0.14
R6995:Dnm1l UTSW 16 16329807 nonsense probably null
R7309:Dnm1l UTSW 16 16321646 missense probably damaging 1.00
R7422:Dnm1l UTSW 16 16318474 missense probably benign
R8399:Dnm1l UTSW 16 16321672 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTCTGTAGCTAACTTTGCATGTG -3'
(R):5'- ATCAGAGATTGTTTACCAGAGCT -3'

Sequencing Primer
(F):5'- TCATGAGTTTGAGGACAGCC -3'
(R):5'- GAGATTGTTTACCAGAGCTGAAAAC -3'
Posted On2016-10-26