Mutagenetix > Incidental Mutations

Incidental Mutation 'R5574:Adamts1'

437136

Institutional Source

Beutler Lab

Gene Symbol

Adamts1

Ensembl Gene

ENSMUSG00000022893

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1

Synonyms

METH1, ADAMTS-1, ADAM-TS1, METH-1

MMRRC Submission

043129-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85793827-85803113 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 85799642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 106 (D106E)

Ref Sequence

ENSEMBL: ENSMUSP00000118471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023610] [ENSMUST00000125897]

AlphaFold

P97857

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023610
AA Change: D369E

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023610
Gene: ENSMUSG00000022893
AA Change: D369E

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	22	194	1.3e-27	PFAM
Pfam:Reprolysin_4	257	464	2.2e-9	PFAM
Pfam:Reprolysin_5	257	466	1.6e-14	PFAM
Pfam:Reprolysin	259	468	3.6e-22	PFAM
Pfam:Reprolysin_2	279	458	2.1e-10	PFAM
Pfam:Reprolysin_3	281	413	4.8e-14	PFAM
ACR	469	549	7.36e-8	SMART
TSP1	563	615	3.77e-14	SMART
Pfam:ADAM_spacer1	726	844	1.7e-35	PFAM
TSP1	858	911	1.22e-8	SMART
TSP1	912	968	1.2e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125897
AA Change: D106E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118471
Gene: ENSMUSG00000022893
AA Change: D106E

Domain	Start	End	E-Value	Type
Pfam:Reprolysin_4	1	201	2.3e-9	PFAM
Pfam:Reprolysin_5	1	203	8.8e-14	PFAM
Pfam:Reprolysin	1	205	5e-22	PFAM
Pfam:Reprolysin_2	16	195	8.6e-10	PFAM
Pfam:Reprolysin_3	19	150	4.2e-14	PFAM
ACR	206	286	7.36e-8	SMART
TSP1	300	352	3.77e-14	SMART
Pfam:ADAM_spacer1	463	581	3e-35	PFAM
TSP1	595	648	1.22e-8	SMART
TSP1	649	680	4.85e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138474

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family and preproprotein that is proteolytically processed to generate a mature protein product. This secreted protein product plays an important role in ovulation, likely through its cleavage of the extracellular matrix component versican. The encoded protein may enhance tumorigenesis in a mouse model of breast cancer. Homozygous knockout mice for this gene exhibit enhanced perinatal lethality, impaired growth and adipose tissue development, and impaired ovulation in females. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display growth retardation with adipose tissue malformation, impaired female fertility, enlarged renal calices and abnormal adrenal medullary architecture. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	T	A	14: 59,142,756	N31I	possibly damaging	Het
3110002H16Rik	CTGTGTGTT	CTGTGTGTTGTGTGTT	18: 12,185,006		probably null	Het
Acvr1b	T	A	15: 101,202,077	M304K	probably benign	Het
Blm	C	A	7: 80,499,773	C696F	probably damaging	Het
Bnip3l-ps	T	A	12: 18,217,118		noncoding transcript	Het
C87499	T	G	4: 88,628,043	E354A	probably benign	Het
Ccdc171	A	T	4: 83,693,753	N895I	probably damaging	Het
Cdhr4	A	T	9: 107,993,328		probably benign	Het
Cfap97	T	C	8: 46,170,142	S190P	probably damaging	Het
Chrnb1	A	C	11: 69,793,683		probably benign	Het
Clns1a	A	G	7: 97,720,958		probably benign	Het
Col8a2	G	A	4: 126,311,268		probably benign	Het
Cr2	T	A	1: 195,141,236	E721V	probably damaging	Het
Csk	A	G	9: 57,629,301	V172A	probably benign	Het
Cyp2g1	G	A	7: 26,820,740	V466M	possibly damaging	Het
Cyp4f13	A	G	17: 32,929,205	Y349H	probably benign	Het
Dnm1l	T	C	16: 16,329,821	Y205C	probably damaging	Het
Dync1i2	A	T	2: 71,233,650	T113S	probably benign	Het
Edem2	T	C	2: 155,716,155	E186G	probably damaging	Het
Eya2	G	A	2: 165,763,816	R380H	probably damaging	Het
Fam214a	A	T	9: 75,010,390	D757V	probably damaging	Het
Fam60a	C	T	6: 148,944,880		probably benign	Het
Gldn	A	G	9: 54,312,922	T132A	probably damaging	Het
Gm13941	A	T	2: 111,100,606	I74K	unknown	Het
Gm3898	C	T	9: 43,830,042		noncoding transcript	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Klhdc10	C	T	6: 30,439,865	L127F	possibly damaging	Het
Letm1	G	A	5: 33,769,386	T189M	possibly damaging	Het
Lrrc17	A	T	5: 21,570,357	I306F	possibly damaging	Het
Lrrk2	T	A	15: 91,787,016	V2000E	probably damaging	Het
Mettl9	A	T	7: 121,047,870	E66D	probably benign	Het
Mroh1	T	A	15: 76,433,931	V877D	probably benign	Het
Mycbp2	C	T	14: 103,142,767	V3760M	possibly damaging	Het
Nos3	A	G	5: 24,368,861	T208A	possibly damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Obp2a	A	T	2: 25,700,830	T70S	possibly damaging	Het
Olfr1040	T	C	2: 86,146,191	D181G	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr1245	C	T	2: 89,574,977	V250I	possibly damaging	Het
Olfr145	A	T	9: 37,897,581	Y59F	probably damaging	Het
Olfr69	T	G	7: 103,768,116	I94L	possibly damaging	Het
Pate2	A	G	9: 35,686,115		probably benign	Het
Pdzph1	A	G	17: 58,973,947	F447L	probably benign	Het
Pias1	A	G	9: 62,920,493	C211R	probably damaging	Het
Plb1	A	G	5: 32,329,947	S929G	probably benign	Het
Prc1	G	A	7: 80,294,542		probably benign	Het
Prex2	A	G	1: 11,140,058	D574G	probably damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rock2	T	C	12: 16,961,641	M690T	possibly damaging	Het
Slc18a2	A	G	19: 59,261,405	I25V	probably benign	Het
Slc9a5	T	A	8: 105,364,691	I701K	probably benign	Het
Sorcs1	T	A	19: 50,222,133	N765Y	probably damaging	Het
Ssh2	A	T	11: 77,450,115	I698L	probably benign	Het
Stam	A	G	2: 14,115,864	D58G	probably damaging	Het
Thsd4	C	A	9: 59,972,400	R1018L	probably damaging	Het
Tnxb	A	G	17: 34,711,024	T2911A	probably benign	Het
Trpm7	A	C	2: 126,813,030	F1329L	probably benign	Het
Ttll9	A	G	2: 152,984,248	E126G	possibly damaging	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Unc45a	G	A	7: 80,334,856	A232V	probably damaging	Het
Utp14b	G	A	1: 78,666,409	V675M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,891	H279L	probably benign	Het
Vmn2r75	G	T	7: 86,166,302	A118E	probably benign	Het
Wdr36	A	T	18: 32,865,959	Q886L	probably damaging	Het
Zfp433	T	A	10: 81,719,291	Y27*	probably null	Het
Zfp715	A	T	7: 43,311,039	S43T	possibly damaging	Het
Zfyve26	A	G	12: 79,239,924	S2297P	possibly damaging	Het

Other mutations in Adamts1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Adamts1	APN	16	85795573	missense	probably benign
IGL01753:Adamts1	APN	16	85802224	missense	probably benign	0.00
IGL02238:Adamts1	APN	16	85795825	missense	probably benign	0.01
IGL02655:Adamts1	APN	16	85802617	missense	probably benign
gambler	UTSW	16	85799609	nonsense	probably null
sure_thing	UTSW	16	85798544	missense	probably damaging	1.00
PIT4466001:Adamts1	UTSW	16	85796691	nonsense	probably null
R0114:Adamts1	UTSW	16	85799614	missense	probably benign	0.10
R0135:Adamts1	UTSW	16	85798703	splice site	probably benign
R0179:Adamts1	UTSW	16	85795465	missense	probably benign	0.00
R0517:Adamts1	UTSW	16	85800353	missense	possibly damaging	0.96
R0526:Adamts1	UTSW	16	85802372	missense	probably benign
R0727:Adamts1	UTSW	16	85798648	missense	possibly damaging	0.51
R0899:Adamts1	UTSW	16	85798052	nonsense	probably null
R1163:Adamts1	UTSW	16	85802637	missense	probably benign	0.07
R1555:Adamts1	UTSW	16	85797888	missense	probably benign	0.17
R1598:Adamts1	UTSW	16	85798511	nonsense	probably null
R1643:Adamts1	UTSW	16	85796817	splice site	probably benign
R1847:Adamts1	UTSW	16	85802226	missense	possibly damaging	0.89
R2045:Adamts1	UTSW	16	85795976	missense	probably damaging	1.00
R2093:Adamts1	UTSW	16	85802445	missense	probably benign	0.23
R2966:Adamts1	UTSW	16	85796774	missense	possibly damaging	0.94
R3937:Adamts1	UTSW	16	85795619	missense	possibly damaging	0.90
R3938:Adamts1	UTSW	16	85795619	missense	possibly damaging	0.90
R4348:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4350:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4351:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4352:Adamts1	UTSW	16	85802346	missense	probably benign	0.02
R4470:Adamts1	UTSW	16	85798516	missense	possibly damaging	0.88
R4724:Adamts1	UTSW	16	85802505	missense	probably benign	0.00
R4775:Adamts1	UTSW	16	85800390	nonsense	probably null
R4972:Adamts1	UTSW	16	85795945	missense	probably damaging	1.00
R5353:Adamts1	UTSW	16	85802608	missense	probably benign	0.00
R5420:Adamts1	UTSW	16	85799609	nonsense	probably null
R5551:Adamts1	UTSW	16	85797746	missense	probably benign
R5759:Adamts1	UTSW	16	85798048	missense	possibly damaging	0.93
R5860:Adamts1	UTSW	16	85798544	missense	probably damaging	1.00
R5910:Adamts1	UTSW	16	85802149	missense	probably benign	0.00
R6240:Adamts1	UTSW	16	85802157	missense	probably benign
R6473:Adamts1	UTSW	16	85799643	missense	probably damaging	1.00
R6623:Adamts1	UTSW	16	85795637	missense	probably benign	0.20
R6628:Adamts1	UTSW	16	85795825	missense	probably benign	0.05
R7034:Adamts1	UTSW	16	85802746	unclassified	probably benign
R7174:Adamts1	UTSW	16	85799172	missense	probably benign	0.00
R7572:Adamts1	UTSW	16	85797741	missense	possibly damaging	0.51
R7759:Adamts1	UTSW	16	85797795	missense	probably damaging	1.00
R7808:Adamts1	UTSW	16	85800229	missense	probably damaging	0.99
R7880:Adamts1	UTSW	16	85798052	nonsense	probably null
R7985:Adamts1	UTSW	16	85798114	missense	probably damaging	1.00
R7986:Adamts1	UTSW	16	85799547	missense	probably damaging	1.00
R8118:Adamts1	UTSW	16	85795933	missense	probably damaging	1.00
R8466:Adamts1	UTSW	16	85802512	missense	probably benign	0.42
R8468:Adamts1	UTSW	16	85795556	missense	possibly damaging	0.52
R8712:Adamts1	UTSW	16	85798008	missense	probably benign	0.28
R8721:Adamts1	UTSW	16	85797887	missense	probably damaging	0.96
R8804:Adamts1	UTSW	16	85802412	missense	probably damaging	1.00
R9188:Adamts1	UTSW	16	85802683	missense	probably damaging	0.96
R9297:Adamts1	UTSW	16	85802646	missense	probably benign	0.01
R9346:Adamts1	UTSW	16	85802532	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AAAATTGCTGGTGGCTGAGG -3'
(R):5'- AGGGAATCTTGCTTTAGAGTCAG -3'

Sequencing Primer
(F):5'- CTGAGGTAGCAACATAGTCTGAG -3'
(R):5'- TAGAGTCAGTCCTTCAAGTCCAG -3'

Posted On

2016-10-26