Incidental Mutation 'R5574:Sorcs1'
ID 437142
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 043129-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50210571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 765 (N765Y)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211687] [ENSMUST00000211008]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000072685
AA Change: N765Y

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: N765Y

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111756
AA Change: N765Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: N765Y

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164039
AA Change: N765Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: N765Y

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209413
AA Change: N765Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209783
AA Change: N765Y

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000211687
AA Change: N765Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211008
AA Change: N765Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1714 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,380,205 (GRCm39) N31I possibly damaging Het
Acvr1b T A 15: 101,099,958 (GRCm39) M304K probably benign Het
Adamts1 G T 16: 85,596,530 (GRCm39) D106E probably damaging Het
Atosa A T 9: 74,917,672 (GRCm39) D757V probably damaging Het
Blm C A 7: 80,149,521 (GRCm39) C696F probably damaging Het
Bnip3l-ps T A 12: 18,267,119 (GRCm39) noncoding transcript Het
Ccdc171 A T 4: 83,611,990 (GRCm39) N895I probably damaging Het
Cdhr4 A T 9: 107,870,527 (GRCm39) probably benign Het
Cfap97 T C 8: 46,623,179 (GRCm39) S190P probably damaging Het
Chrnb1 A C 11: 69,684,509 (GRCm39) probably benign Het
Clns1a A G 7: 97,370,165 (GRCm39) probably benign Het
Col8a2 G A 4: 126,205,061 (GRCm39) probably benign Het
Cr2 T A 1: 194,823,544 (GRCm39) E721V probably damaging Het
Csk A G 9: 57,536,584 (GRCm39) V172A probably benign Het
Cyp2g1 G A 7: 26,520,165 (GRCm39) V466M possibly damaging Het
Cyp4f13 A G 17: 33,148,179 (GRCm39) Y349H probably benign Het
Dnm1l T C 16: 16,147,685 (GRCm39) Y205C probably damaging Het
Dync1i2 A T 2: 71,063,994 (GRCm39) T113S probably benign Het
Edem2 T C 2: 155,558,075 (GRCm39) E186G probably damaging Het
Eya2 G A 2: 165,605,736 (GRCm39) R380H probably damaging Het
Gldn A G 9: 54,220,206 (GRCm39) T132A probably damaging Het
Gm13941 A T 2: 110,930,951 (GRCm39) I74K unknown Het
Gm3898 C T 9: 43,741,339 (GRCm39) noncoding transcript Het
Ighmbp2 C T 19: 3,321,536 (GRCm39) V408I probably benign Het
Klhdc10 C T 6: 30,439,864 (GRCm39) L127F possibly damaging Het
Letm1 G A 5: 33,926,730 (GRCm39) T189M possibly damaging Het
Lrrc17 A T 5: 21,775,355 (GRCm39) I306F possibly damaging Het
Lrrk2 T A 15: 91,671,219 (GRCm39) V2000E probably damaging Het
Mettl9 A T 7: 120,647,093 (GRCm39) E66D probably benign Het
Mroh1 T A 15: 76,318,131 (GRCm39) V877D probably benign Het
Mycbp2 C T 14: 103,380,203 (GRCm39) V3760M possibly damaging Het
Nos3 A G 5: 24,573,859 (GRCm39) T208A possibly damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Obp2a A T 2: 25,590,842 (GRCm39) T70S possibly damaging Het
Or4a72 C T 2: 89,405,321 (GRCm39) V250I possibly damaging Het
Or52a5b T G 7: 103,417,323 (GRCm39) I94L possibly damaging Het
Or5al6 T C 2: 85,976,535 (GRCm39) D181G probably damaging Het
Or8b8 A T 9: 37,808,877 (GRCm39) Y59F probably damaging Het
Or8h10 A G 2: 86,808,867 (GRCm39) V91A probably benign Het
Pate2 A G 9: 35,597,411 (GRCm39) probably benign Het
Pdzph1 A G 17: 59,280,942 (GRCm39) F447L probably benign Het
Pias1 A G 9: 62,827,775 (GRCm39) C211R probably damaging Het
Plb1 A G 5: 32,487,291 (GRCm39) S929G probably benign Het
Pramel32 T G 4: 88,546,280 (GRCm39) E354A probably benign Het
Prc1 G A 7: 79,944,290 (GRCm39) probably benign Het
Prex2 A G 1: 11,210,282 (GRCm39) D574G probably damaging Het
Rapgef4 G A 2: 71,864,464 (GRCm39) probably null Het
Rmc1 CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,318,063 (GRCm39) probably null Het
Rock2 T C 12: 17,011,642 (GRCm39) M690T possibly damaging Het
Sinhcaf C T 6: 148,846,378 (GRCm39) probably benign Het
Slc18a2 A G 19: 59,249,837 (GRCm39) I25V probably benign Het
Slc9a5 T A 8: 106,091,323 (GRCm39) I701K probably benign Het
Ssh2 A T 11: 77,340,941 (GRCm39) I698L probably benign Het
Stam A G 2: 14,120,675 (GRCm39) D58G probably damaging Het
Thsd4 C A 9: 59,879,683 (GRCm39) R1018L probably damaging Het
Tnxb A G 17: 34,929,998 (GRCm39) T2911A probably benign Het
Trpm7 A C 2: 126,654,950 (GRCm39) F1329L probably benign Het
Ttll9 A G 2: 152,826,168 (GRCm39) E126G possibly damaging Het
Tubgcp5 G A 7: 55,455,077 (GRCm39) V258M probably benign Het
Unc45a G A 7: 79,984,604 (GRCm39) A232V probably damaging Het
Utp14b G A 1: 78,644,126 (GRCm39) V675M probably damaging Het
Vmn2r67 T A 7: 84,801,099 (GRCm39) H279L probably benign Het
Vmn2r75 G T 7: 85,815,510 (GRCm39) A118E probably benign Het
Wdr36 A T 18: 32,999,012 (GRCm39) Q886L probably damaging Het
Zfp433 T A 10: 81,555,125 (GRCm39) Y27* probably null Het
Zfp715 A T 7: 42,960,463 (GRCm39) S43T possibly damaging Het
Zfyve26 A G 12: 79,286,698 (GRCm39) S2297P possibly damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATGTATCCCCATAACCTTGCAC -3'
(R):5'- CCTAGAAGACTTAAGCATTTAGGC -3'

Sequencing Primer
(F):5'- GTCTCTGTCTCTCACACACACATAC -3'
(R):5'- ATTGACTGATTAGAAGTTGGTTGTC -3'
Posted On 2016-10-26