Incidental Mutation 'R0046:Pmfbp1'
ID43715
Institutional Source Beutler Lab
Gene Symbol Pmfbp1
Ensembl Gene ENSMUSG00000031727
Gene Namepolyamine modulated factor 1 binding protein 1
SynonymsF77, 1700016D22Rik
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109494027-109542640 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 109535985 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034162]
Predicted Effect probably benign
Transcript: ENSMUST00000034162
SMART Domains Protein: ENSMUSP00000034162
Gene: ENSMUSG00000031727

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
internal_repeat_1 38 84 9.43e-6 PROSPERO
coiled coil region 89 121 N/A INTRINSIC
internal_repeat_1 138 178 9.43e-6 PROSPERO
coiled coil region 197 223 N/A INTRINSIC
coiled coil region 334 377 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
coiled coil region 411 732 N/A INTRINSIC
coiled coil region 758 879 N/A INTRINSIC
coiled coil region 931 968 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212003
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Pmfbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Pmfbp1 APN 8 109537993 missense possibly damaging 0.75
IGL01505:Pmfbp1 APN 8 109513911 missense probably damaging 1.00
IGL01609:Pmfbp1 APN 8 109527716 missense probably benign 0.12
IGL02066:Pmfbp1 APN 8 109541733 missense possibly damaging 0.76
IGL02926:Pmfbp1 APN 8 109520249 missense probably damaging 1.00
IGL03374:Pmfbp1 APN 8 109542414 utr 3 prime probably benign
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0068:Pmfbp1 UTSW 8 109542379 splice site probably benign
R0211:Pmfbp1 UTSW 8 109541740 missense probably benign 0.03
R0244:Pmfbp1 UTSW 8 109541673 missense probably damaging 1.00
R0468:Pmfbp1 UTSW 8 109513968 splice site probably null
R0479:Pmfbp1 UTSW 8 109530473 splice site probably benign
R1124:Pmfbp1 UTSW 8 109530483 critical splice acceptor site probably null
R1332:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1336:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1621:Pmfbp1 UTSW 8 109499538 missense probably benign 0.04
R1961:Pmfbp1 UTSW 8 109530144 splice site probably benign
R2069:Pmfbp1 UTSW 8 109532103 missense possibly damaging 0.68
R2125:Pmfbp1 UTSW 8 109520273 missense probably damaging 1.00
R2889:Pmfbp1 UTSW 8 109525431 missense probably damaging 0.99
R3034:Pmfbp1 UTSW 8 109520921 critical splice acceptor site probably null
R3956:Pmfbp1 UTSW 8 109530169 missense probably benign 0.25
R4085:Pmfbp1 UTSW 8 109494947 missense possibly damaging 0.92
R4191:Pmfbp1 UTSW 8 109527628 missense probably benign 0.00
R4410:Pmfbp1 UTSW 8 109532063 missense probably benign 0.07
R4418:Pmfbp1 UTSW 8 109530633 missense probably benign 0.36
R4888:Pmfbp1 UTSW 8 109532160 missense probably damaging 1.00
R4937:Pmfbp1 UTSW 8 109535866 missense probably benign
R5070:Pmfbp1 UTSW 8 109530155 missense probably damaging 0.99
R5184:Pmfbp1 UTSW 8 109527767 missense possibly damaging 0.92
R5552:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
R5609:Pmfbp1 UTSW 8 109525107 missense probably damaging 1.00
R5760:Pmfbp1 UTSW 8 109521023 missense probably damaging 0.99
R5818:Pmfbp1 UTSW 8 109538679 splice site probably null
R6378:Pmfbp1 UTSW 8 109530266 missense probably damaging 0.99
R6496:Pmfbp1 UTSW 8 109532157 missense probably null 0.04
R6550:Pmfbp1 UTSW 8 109520207 missense possibly damaging 0.90
R6565:Pmfbp1 UTSW 8 109525428 nonsense probably null
R6624:Pmfbp1 UTSW 8 109530190 missense possibly damaging 0.92
R6684:Pmfbp1 UTSW 8 109535830 missense probably benign 0.10
R6823:Pmfbp1 UTSW 8 109530307 missense possibly damaging 0.92
R6833:Pmfbp1 UTSW 8 109538675 critical splice donor site probably null
R6940:Pmfbp1 UTSW 8 109525191 missense probably damaging 0.98
R7000:Pmfbp1 UTSW 8 109530589 missense possibly damaging 0.92
R7411:Pmfbp1 UTSW 8 109513871 missense probably damaging 1.00
R7563:Pmfbp1 UTSW 8 109525374 missense possibly damaging 0.83
R7782:Pmfbp1 UTSW 8 109527780 missense probably damaging 0.96
R8115:Pmfbp1 UTSW 8 109537037 missense probably damaging 1.00
X0065:Pmfbp1 UTSW 8 109535867 missense probably benign 0.25
Z1088:Pmfbp1 UTSW 8 109513944 missense probably damaging 1.00
Z1176:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTCCCTAAAGATAGCCCGCCAG -3'
(R):5'- ACCCTGTCTGTGAATCACCAGTGAG -3'

Sequencing Primer
(F):5'- CCGCCAGAAGGATTCCATC -3'
(R):5'- ATTGACTCCTGTCCACTCGT -3'
Posted On2013-05-29