Incidental Mutation 'R0046:Nrp1'
ID43716
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Nameneuropilin 1
SynonymsNeuropilin-1, NP-1, NPN-1, Npn1
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0046 (G1)
Quality Score142
Status Validated
Chromosome8
Chromosomal Location128358604-128503363 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 128500608 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
PDB Structure
Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026917
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 128476207 missense probably benign
IGL01412:Nrp1 APN 8 128418707 splice site probably benign
IGL01586:Nrp1 APN 8 128432032 missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 128502720 missense probably damaging 1.00
IGL02500:Nrp1 APN 8 128425799 missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 128493031 missense probably benign
R0281:Nrp1 UTSW 8 128460683 missense probably damaging 0.96
R0403:Nrp1 UTSW 8 128457969 missense probably damaging 1.00
R0610:Nrp1 UTSW 8 128502618 missense probably damaging 1.00
R1055:Nrp1 UTSW 8 128468598 missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 128418716 nonsense probably null
R1263:Nrp1 UTSW 8 128468389 missense probably damaging 1.00
R1340:Nrp1 UTSW 8 128434355 missense probably damaging 1.00
R1397:Nrp1 UTSW 8 128418716 nonsense probably null
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1531:Nrp1 UTSW 8 128425969 missense probably null 0.19
R1587:Nrp1 UTSW 8 128476282 missense probably damaging 1.00
R1719:Nrp1 UTSW 8 128425885 missense probably damaging 1.00
R1733:Nrp1 UTSW 8 128468493 missense probably benign 0.02
R1785:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R1786:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2047:Nrp1 UTSW 8 128498096 splice site probably benign
R2130:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2132:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2133:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2163:Nrp1 UTSW 8 128497871 missense probably damaging 1.00
R2338:Nrp1 UTSW 8 128497904 missense probably benign 0.01
R2407:Nrp1 UTSW 8 128431945 missense probably damaging 0.99
R3405:Nrp1 UTSW 8 128498088 nonsense probably null
R3748:Nrp1 UTSW 8 128457980 missense probably damaging 1.00
R4347:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R4379:Nrp1 UTSW 8 128468467 missense probably damaging 1.00
R4646:Nrp1 UTSW 8 128457944 missense probably benign 0.00
R4688:Nrp1 UTSW 8 128502566 missense probably benign 0.01
R4916:Nrp1 UTSW 8 128502804 nonsense probably null
R5077:Nrp1 UTSW 8 128500673 critical splice donor site probably null
R5301:Nrp1 UTSW 8 128434197 splice site probably null
R5509:Nrp1 UTSW 8 128425915 missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 128468448 missense probably benign 0.22
R5873:Nrp1 UTSW 8 128468377 missense probably damaging 1.00
R5987:Nrp1 UTSW 8 128476169 missense probably damaging 1.00
R6060:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
R6757:Nrp1 UTSW 8 128425868 missense probably damaging 1.00
R6889:Nrp1 UTSW 8 128493057 missense probably damaging 1.00
R7025:Nrp1 UTSW 8 128480954 missense probably damaging 1.00
R7065:Nrp1 UTSW 8 128460712 missense probably benign
R7290:Nrp1 UTSW 8 128476296 critical splice donor site probably null
R7369:Nrp1 UTSW 8 128431915 missense probably damaging 1.00
R7553:Nrp1 UTSW 8 128431987 missense probably damaging 1.00
R7650:Nrp1 UTSW 8 128498014 missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 128432023 missense probably benign 0.00
X0066:Nrp1 UTSW 8 128460645 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCCAACCCCAAAGAGTCATTGTG -3'
(R):5'- TTTTATCTGAACTGCCTGGAGGCAC -3'

Sequencing Primer
(F):5'- ACACCCTCATAGTGATGGGTC -3'
(R):5'- CTGGAGGCACTAGTGTATTTAGGA -3'
Posted On2013-05-29