Incidental Mutation 'R5575:B9d2'
ID437162
Institutional Source Beutler Lab
Gene Symbol B9d2
Ensembl Gene ENSMUSG00000063439
Gene NameB9 protein domain 2
Synonymsstumpy
MMRRC Submission 043130-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5575 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25680780-25686558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25683332 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 44 (T44A)
Ref Sequence ENSEMBL: ENSMUSP00000146289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000108403] [ENSMUST00000205325] [ENSMUST00000205658] [ENSMUST00000206913]
Predicted Effect probably benign
Transcript: ENSMUST00000002678
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108403
AA Change: T44A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104040
Gene: ENSMUSG00000063439
AA Change: T44A

DomainStartEndE-ValueType
Pfam:B9-C2 4 164 5.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205325
AA Change: T44A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000205658
AA Change: T44A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206584
Predicted Effect probably damaging
Transcript: ENSMUST00000206913
AA Change: T36A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.8784 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B9 domain protein, which are exclusively found in ciliated organisms. The gene is upregulated during mucociliary differentiation, and the encoded protein localizes to basal bodies and cilia. Disrupting expression of this gene results in ciliogenesis defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice carrying a targeted mutation of this gene exhibit preweaning lethality, hydrops fetalis, and abnormalities in craniofacial, limb, and eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,678,738 probably null Het
Adrm1 T G 2: 180,175,716 D325E probably benign Het
Anapc4 T A 5: 52,855,871 V433E probably damaging Het
Aplf A C 6: 87,646,147 C338G probably benign Het
Atad5 A G 11: 80,100,323 T681A probably benign Het
Catsperg2 T C 7: 29,705,590 K81R possibly damaging Het
Cep170b T A 12: 112,735,632 H286Q probably damaging Het
Cfap61 G A 2: 146,017,393 V434I probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col9a3 A T 2: 180,598,846 probably benign Het
Dsc2 A T 18: 20,035,390 C671S probably damaging Het
Eif5 T C 12: 111,542,306 V245A probably damaging Het
Epha5 G A 5: 84,416,502 R2W probably damaging Het
Fam129a A T 1: 151,718,240 H892L probably benign Het
Gabrb2 G A 11: 42,529,538 probably benign Het
Gm3453 A G 14: 5,978,205 V66A possibly damaging Het
Gna15 T C 10: 81,523,873 I28V probably damaging Het
Hk3 A T 13: 55,014,770 D88E probably damaging Het
Hmbox1 T C 14: 64,823,164 T375A probably benign Het
Ibsp A T 5: 104,310,059 E154V possibly damaging Het
Il7r A G 15: 9,508,187 S350P probably benign Het
Isx T C 8: 74,892,801 L207P probably benign Het
Krt35 T C 11: 100,094,624 E197G probably damaging Het
Krt78 G A 15: 101,947,352 Q675* probably null Het
March1 T A 8: 66,468,310 V217E probably damaging Het
Mertk T C 2: 128,736,565 I157T probably damaging Het
Mmab A T 5: 114,436,771 L147Q probably damaging Het
Ndst4 T A 3: 125,437,830 V16D probably benign Het
Ogdhl T C 14: 32,325,847 L18P possibly damaging Het
Pikfyve A C 1: 65,273,730 H2089P probably damaging Het
Plxna1 A T 6: 89,324,541 L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,552,832 F246S probably damaging Het
Ptbp2 A T 3: 119,720,783 probably null Het
Ptbp2 G A 3: 119,720,789 P463L possibly damaging Het
Rad51 A G 2: 119,134,433 D274G probably benign Het
Ranbp2 T C 10: 58,492,583 V2807A probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rp1l1 C T 14: 64,030,984 H1340Y probably benign Het
Ryr1 T A 7: 29,078,693 H2133L possibly damaging Het
Scgb1c1 G A 7: 140,846,111 G40E probably damaging Het
Shank2 T C 7: 144,410,134 I703T probably damaging Het
Spag17 G A 3: 100,053,822 A975T possibly damaging Het
Supt6 T C 11: 78,228,961 D400G probably damaging Het
Synrg T C 11: 84,009,552 probably null Het
Thada A C 17: 84,416,399 probably null Het
Themis3 A G 17: 66,555,326 S546P possibly damaging Het
Tinf2 T C 14: 55,680,174 D286G probably benign Het
Tmem67 A T 4: 12,047,886 V815D possibly damaging Het
Trpm1 T C 7: 64,220,270 L441P possibly damaging Het
Vapa A G 17: 65,613,252 V16A probably benign Het
Vmn2r38 A T 7: 9,075,636 Y582* probably null Het
Vps13b A T 15: 35,929,919 K3934I probably damaging Het
Wrn G A 8: 33,336,130 T168I probably benign Het
Other mutations in B9d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03118:B9d2 APN 7 25681476 critical splice donor site probably null
R0607:B9d2 UTSW 7 25683332 missense probably damaging 1.00
R4281:B9d2 UTSW 7 25681426 missense possibly damaging 0.69
R5179:B9d2 UTSW 7 25681401 missense probably damaging 1.00
R5908:B9d2 UTSW 7 25683299 missense probably damaging 1.00
R6921:B9d2 UTSW 7 25686017 missense probably damaging 1.00
R7560:B9d2 UTSW 7 25681359 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGACACTTGGCTCTAGAGTCTAC -3'
(R):5'- AGGCCTCAAATGCACTGCTC -3'

Sequencing Primer
(F):5'- GGCTCTAGAGTCTACACTGTGTAAC -3'
(R):5'- TCAAATGCACTGCTCTAGGG -3'
Posted On2016-10-26