Mutagenetix > Incidental Mutation

Incidental Mutation 'R5575:Trpm1'

437165

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

043130-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5575 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64220270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 441 (L441P)

Ref Sequence

ENSEMBL: ENSMUSP00000134947 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: L557P

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L557P

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107516
AA Change: C557R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140277
AA Change: L148P

Predicted Effect

probably benign
Transcript: ENSMUST00000176623
AA Change: L65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134805
Gene: ENSMUSG00000030523
AA Change: L65P

Domain	Start	End	E-Value	Type
Blast:ANK	13	41	1e-6	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177102
AA Change: L441P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: L441P

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205610

Predicted Effect

probably benign
Transcript: ENSMUST00000205731

Predicted Effect

probably benign
Transcript: ENSMUST00000205994
AA Change: L65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: L441P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: L557P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206740

Meta Mutation Damage Score

0.2254

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	C	T	14: 54,678,738		probably null	Het
Adrm1	T	G	2: 180,175,716	D325E	probably benign	Het
Anapc4	T	A	5: 52,855,871	V433E	probably damaging	Het
Aplf	A	C	6: 87,646,147	C338G	probably benign	Het
Atad5	A	G	11: 80,100,323	T681A	probably benign	Het
B9d2	A	G	7: 25,683,332	T44A	probably damaging	Het
Catsperg2	T	C	7: 29,705,590	K81R	possibly damaging	Het
Cep170b	T	A	12: 112,735,632	H286Q	probably damaging	Het
Cfap61	G	A	2: 146,017,393	V434I	probably benign	Het
Col5a2	A	T	1: 45,378,482	I1311N	probably damaging	Het
Col9a3	A	T	2: 180,598,846		probably benign	Het
Dsc2	A	T	18: 20,035,390	C671S	probably damaging	Het
Eif5	T	C	12: 111,542,306	V245A	probably damaging	Het
Epha5	G	A	5: 84,416,502	R2W	probably damaging	Het
Fam129a	A	T	1: 151,718,240	H892L	probably benign	Het
Gabrb2	G	A	11: 42,529,538		probably benign	Het
Gm3453	A	G	14: 5,978,205	V66A	possibly damaging	Het
Gna15	T	C	10: 81,523,873	I28V	probably damaging	Het
Hk3	A	T	13: 55,014,770	D88E	probably damaging	Het
Hmbox1	T	C	14: 64,823,164	T375A	probably benign	Het
Ibsp	A	T	5: 104,310,059	E154V	possibly damaging	Het
Il7r	A	G	15: 9,508,187	S350P	probably benign	Het
Isx	T	C	8: 74,892,801	L207P	probably benign	Het
Krt35	T	C	11: 100,094,624	E197G	probably damaging	Het
Krt78	G	A	15: 101,947,352	Q675*	probably null	Het
March1	T	A	8: 66,468,310	V217E	probably damaging	Het
Mertk	T	C	2: 128,736,565	I157T	probably damaging	Het
Mmab	A	T	5: 114,436,771	L147Q	probably damaging	Het
Ndst4	T	A	3: 125,437,830	V16D	probably benign	Het
Ogdhl	T	C	14: 32,325,847	L18P	possibly damaging	Het
Pikfyve	A	C	1: 65,273,730	H2089P	probably damaging	Het
Plxna1	A	T	6: 89,324,541	L1501Q	possibly damaging	Het
Ppp2r5c	T	C	12: 110,552,832	F246S	probably damaging	Het
Ptbp2	A	T	3: 119,720,783		probably null	Het
Ptbp2	G	A	3: 119,720,789	P463L	possibly damaging	Het
Rad51	A	G	2: 119,134,433	D274G	probably benign	Het
Ranbp2	T	C	10: 58,492,583	V2807A	probably damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rp1l1	C	T	14: 64,030,984	H1340Y	probably benign	Het
Ryr1	T	A	7: 29,078,693	H2133L	possibly damaging	Het
Scgb1c1	G	A	7: 140,846,111	G40E	probably damaging	Het
Shank2	T	C	7: 144,410,134	I703T	probably damaging	Het
Spag17	G	A	3: 100,053,822	A975T	possibly damaging	Het
Supt6	T	C	11: 78,228,961	D400G	probably damaging	Het
Synrg	T	C	11: 84,009,552		probably null	Het
Thada	A	C	17: 84,416,399		probably null	Het
Themis3	A	G	17: 66,555,326	S546P	possibly damaging	Het
Tinf2	T	C	14: 55,680,174	D286G	probably benign	Het
Tmem67	A	T	4: 12,047,886	V815D	possibly damaging	Het
Vapa	A	G	17: 65,613,252	V16A	probably benign	Het
Vmn2r38	A	T	7: 9,075,636	Y582*	probably null	Het
Vps13b	A	T	15: 35,929,919	K3934I	probably damaging	Het
Wrn	G	A	8: 33,336,130	T168I	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACACGTTTGAGTGGGGTAAC -3'
(R):5'- GCACTTTACAGCCATCTATGTC -3'

Sequencing Primer
(F):5'- CCACAGCCAGTTGTCTTATAAAGG -3'
(R):5'- ACAGCCATCTATGTCCCTGG -3'

Posted On

2016-10-26