Incidental Mutation 'R5575:Trpm1'
ID 437165
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 043130-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5575 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63870018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 441 (L441P)
Ref Sequence ENSEMBL: ENSMUSP00000134947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]
AlphaFold Q2TV84
Predicted Effect possibly damaging
Transcript: ENSMUST00000085222
AA Change: L557P

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L557P

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107516
AA Change: C557R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140277
AA Change: L148P
Predicted Effect probably benign
Transcript: ENSMUST00000176623
AA Change: L65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134805
Gene: ENSMUSG00000030523
AA Change: L65P

DomainStartEndE-ValueType
Blast:ANK 13 41 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177102
AA Change: L441P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: L441P

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000205348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205610
Predicted Effect probably benign
Transcript: ENSMUST00000205731
Predicted Effect probably benign
Transcript: ENSMUST00000205994
AA Change: L65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206263
AA Change: L441P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: L557P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably benign
Transcript: ENSMUST00000206706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206740
Meta Mutation Damage Score 0.2254 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,916,195 (GRCm39) probably null Het
Adrm1 T G 2: 179,817,509 (GRCm39) D325E probably benign Het
Anapc4 T A 5: 53,013,213 (GRCm39) V433E probably damaging Het
Aplf A C 6: 87,623,129 (GRCm39) C338G probably benign Het
Atad5 A G 11: 79,991,149 (GRCm39) T681A probably benign Het
B9d2 A G 7: 25,382,757 (GRCm39) T44A probably damaging Het
Catsperg2 T C 7: 29,405,015 (GRCm39) K81R possibly damaging Het
Cep170b T A 12: 112,702,066 (GRCm39) H286Q probably damaging Het
Cfap61 G A 2: 145,859,313 (GRCm39) V434I probably benign Het
Col5a2 A T 1: 45,417,642 (GRCm39) I1311N probably damaging Het
Col9a3 A T 2: 180,240,639 (GRCm39) probably benign Het
Dsc2 A T 18: 20,168,447 (GRCm39) C671S probably damaging Het
Eif5 T C 12: 111,508,740 (GRCm39) V245A probably damaging Het
Epha5 G A 5: 84,564,361 (GRCm39) R2W probably damaging Het
Gabrb2 G A 11: 42,420,365 (GRCm39) probably benign Het
Gm3453 A G 14: 5,978,205 (GRCm38) V66A possibly damaging Het
Gna15 T C 10: 81,359,707 (GRCm39) I28V probably damaging Het
Hk3 A T 13: 55,162,583 (GRCm39) D88E probably damaging Het
Hmbox1 T C 14: 65,060,613 (GRCm39) T375A probably benign Het
Ibsp A T 5: 104,457,925 (GRCm39) E154V possibly damaging Het
Il7r A G 15: 9,508,273 (GRCm39) S350P probably benign Het
Isx T C 8: 75,619,429 (GRCm39) L207P probably benign Het
Krt35 T C 11: 99,985,450 (GRCm39) E197G probably damaging Het
Krt78 G A 15: 101,855,787 (GRCm39) Q675* probably null Het
Marchf1 T A 8: 66,920,962 (GRCm39) V217E probably damaging Het
Mertk T C 2: 128,578,485 (GRCm39) I157T probably damaging Het
Mmab A T 5: 114,574,832 (GRCm39) L147Q probably damaging Het
Ndst4 T A 3: 125,231,479 (GRCm39) V16D probably benign Het
Niban1 A T 1: 151,593,991 (GRCm39) H892L probably benign Het
Ogdhl T C 14: 32,047,804 (GRCm39) L18P possibly damaging Het
Pikfyve A C 1: 65,312,889 (GRCm39) H2089P probably damaging Het
Plxna1 A T 6: 89,301,523 (GRCm39) L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,519,266 (GRCm39) F246S probably damaging Het
Ptbp2 A T 3: 119,514,432 (GRCm39) probably null Het
Ptbp2 G A 3: 119,514,438 (GRCm39) P463L possibly damaging Het
Rad51 A G 2: 118,964,914 (GRCm39) D274G probably benign Het
Ranbp2 T C 10: 58,328,405 (GRCm39) V2807A probably damaging Het
Rapgef4 G A 2: 71,864,464 (GRCm39) probably null Het
Rp1l1 C T 14: 64,268,433 (GRCm39) H1340Y probably benign Het
Ryr1 T A 7: 28,778,118 (GRCm39) H2133L possibly damaging Het
Scgb1c1 G A 7: 140,426,024 (GRCm39) G40E probably damaging Het
Shank2 T C 7: 143,963,871 (GRCm39) I703T probably damaging Het
Spag17 G A 3: 99,961,138 (GRCm39) A975T possibly damaging Het
Supt6 T C 11: 78,119,787 (GRCm39) D400G probably damaging Het
Synrg T C 11: 83,900,378 (GRCm39) probably null Het
Thada A C 17: 84,723,827 (GRCm39) probably null Het
Themis3 A G 17: 66,862,321 (GRCm39) S546P possibly damaging Het
Tinf2 T C 14: 55,917,631 (GRCm39) D286G probably benign Het
Tmem67 A T 4: 12,047,886 (GRCm39) V815D possibly damaging Het
Vapa A G 17: 65,920,247 (GRCm39) V16A probably benign Het
Vmn2r38 A T 7: 9,078,635 (GRCm39) Y582* probably null Het
Vps13b A T 15: 35,930,065 (GRCm39) K3934I probably damaging Het
Wrn G A 8: 33,826,158 (GRCm39) T168I probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACACGTTTGAGTGGGGTAAC -3'
(R):5'- GCACTTTACAGCCATCTATGTC -3'

Sequencing Primer
(F):5'- CCACAGCCAGTTGTCTTATAAAGG -3'
(R):5'- ACAGCCATCTATGTCCCTGG -3'
Posted On 2016-10-26